ID: 1189712297

View in Genome Browser
Species Human (GRCh38)
Location X:43826182-43826204
Sequence CTTTATTTGTGGAATTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189712292_1189712297 17 Left 1189712292 X:43826142-43826164 CCAGTTTATCTGTAACTCAACTG 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1189712297 X:43826182-43826204 CTTTATTTGTGGAATTTGGGTGG 0: 1
1: 0
2: 1
3: 26
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189712297 Original CRISPR CTTTATTTGTGGAATTTGGG TGG Intronic
900419419 1:2549284-2549306 CTTTATGTCTGGAAGTCGGGGGG - Intergenic
904516947 1:31063598-31063620 TTTTATTTGTATAATTTGTGAGG - Intronic
905846727 1:41240682-41240704 CTTATTTTGTGGAAATTTGGGGG - Intronic
906089657 1:43167905-43167927 TTTTAGTTGTCAAATTTGGGAGG - Intronic
906643513 1:47456602-47456624 ACTTATTTGTGGAATTAGGCAGG + Intergenic
908628938 1:66080262-66080284 GGTGATTTGTGGAATTTGGTTGG - Intronic
909991564 1:82229045-82229067 CTTTTTTTGTTGACATTGGGAGG + Intergenic
912076972 1:105887104-105887126 CTAAATTTGTGGATTTTTGGTGG - Intergenic
912766574 1:112417816-112417838 TTTTATTTATGGAGTTTTGGGGG + Intronic
912784938 1:112592974-112592996 GTCTTATTGTGGAATTTGGGGGG - Intronic
913652703 1:120933608-120933630 ATATATTAGTAGAATTTGGGGGG + Intergenic
913791071 1:122527648-122527670 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913794599 1:122591232-122591254 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913804816 1:122775153-122775175 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913806317 1:122802018-122802040 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913807158 1:122816973-122816995 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913810644 1:122879872-122879894 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913810665 1:122880212-122880234 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913819048 1:123029432-123029454 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913821571 1:123074981-123075003 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913836199 1:123336854-123336876 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913841554 1:123432345-123432367 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913852301 1:123626243-123626265 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913856388 1:123700010-123700032 CTCTTTTTGTGGAATTTGCAGGG + Intergenic
913861021 1:123782435-123782457 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913861805 1:123796374-123796396 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913870707 1:123956609-123956631 CTGTTTTTGTGGAATTTGCAAGG + Intergenic
913886813 1:124245080-124245102 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913891796 1:124334307-124334329 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913892593 1:124348587-124348609 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913900084 1:124482348-124482370 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913905377 1:124577840-124577862 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913913656 1:124726045-124726067 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913914754 1:124745756-124745778 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
914168397 1:145195441-145195463 ATATATTAGTAGAATTTGGGGGG - Intergenic
914642885 1:149627729-149627751 ATATATTAGTAGAATTTGGGGGG + Intergenic
917063479 1:171066305-171066327 CTTTATAAGAGGAATATGGGAGG + Intergenic
917608027 1:176655818-176655840 CTTTATTTGTATAATTTATGGGG - Intronic
918091665 1:181300477-181300499 TTTTATTTCTTTAATTTGGGGGG + Intergenic
919199417 1:194335304-194335326 CTTATTTTGTGGATGTTGGGAGG - Intergenic
919899630 1:202034524-202034546 CCTTATTTGGGGAATGGGGGTGG + Intergenic
920422465 1:205844407-205844429 CTTCATTTGTGAAATAAGGGAGG - Intronic
921929702 1:220745296-220745318 CTTCATTTGTAGAATTAGTGAGG - Intergenic
923266077 1:232315502-232315524 CTTTTTTTCTGGAATTTGGTGGG + Intergenic
924132344 1:240924468-240924490 CTTTAATTGTTTAAATTGGGAGG + Intronic
924210270 1:241758024-241758046 GTTTATTTGTTGCATTTGGTTGG + Intronic
924261078 1:242232439-242232461 ATATATTTATGTAATTTGGGGGG + Intronic
924700524 1:246447230-246447252 CTTTATCAGAGGAATTGGGGAGG + Intronic
1063693593 10:8311197-8311219 CTCTAATTTTGGAATTTGGTGGG + Intergenic
1063980789 10:11450112-11450134 CTTCATTTGTGGCCTTTGGTCGG + Intergenic
1064055385 10:12092853-12092875 TTTTATCTGTGGAAATTGGTAGG + Intronic
1064349548 10:14564634-14564656 ATTAACTTGTGCAATTTGGGTGG - Intronic
1064524039 10:16234500-16234522 CTTTATTGTTGGTATTTGGAAGG - Intergenic
1065089286 10:22214164-22214186 CTTTATTTAGGTTATTTGGGTGG - Intergenic
1066377535 10:34870976-34870998 CTTTATTTTTAGAAATTGGCAGG + Intergenic
1066972325 10:42322702-42322724 CTTTTTTTGTAGAATTTGCAAGG + Intergenic
1067263484 10:44715110-44715132 TATTATTTGTGCAATTTGGCTGG + Intergenic
1069484513 10:68812907-68812929 CTTTACTTGTGAGATGTGGGTGG + Intergenic
1071152310 10:82649833-82649855 TCTTAGTGGTGGAATTTGGGTGG + Intronic
1073833078 10:107409215-107409237 CCTTTTTTGTGGAATTTCTGTGG + Intergenic
1073983812 10:109185199-109185221 TCTTATTTTTGCAATTTGGGTGG + Intergenic
1073985705 10:109206232-109206254 CTTTATCTGTGGTTCTTGGGAGG - Intergenic
1074152985 10:110774950-110774972 CCTTATTTATGGTATTTTGGTGG - Intronic
1074586528 10:114772638-114772660 CTTTATTTGTGGAATCCTTGGGG - Intergenic
1075451426 10:122554347-122554369 CTTCATGTGTGGGATTTGGGAGG + Intergenic
1076303326 10:129445034-129445056 ACTTATTAGTGTAATTTGGGGGG - Intergenic
1077372999 11:2192418-2192440 CTTTGGGTGTGGAATATGGGGGG - Intergenic
1078279104 11:9881739-9881761 CTTTATTTGTTTAATTGGGGGGG - Intronic
1079751853 11:24209761-24209783 CTTTATTTGTAGAATTTCAAGGG - Intergenic
1080370086 11:31627701-31627723 CTTTATTAGTGGAAATTTGGAGG - Intronic
1080446326 11:32340986-32341008 ATTTATTTTTGGAATTTGTTTGG - Intergenic
1081227490 11:40542243-40542265 CTTTATTTTTGTAGTTGGGGTGG - Intronic
1083057685 11:59838698-59838720 CTTGCTTAGTGAAATTTGGGAGG - Intronic
1083568323 11:63739977-63739999 TTTGATGTGTGGAATTTGAGGGG + Intronic
1088936939 11:114411556-114411578 CTTTATTATTCAAATTTGGGGGG - Intronic
1089656785 11:119953429-119953451 TTTCATTTCTAGAATTTGGGGGG - Intergenic
1089922234 11:122220248-122220270 CTTGATCTTTGGCATTTGGGAGG + Intergenic
1090534893 11:127630350-127630372 AATTTTATGTGGAATTTGGGTGG + Intergenic
1091369850 11:135048796-135048818 CCTAATTTGCGGAATTTGGAAGG - Intergenic
1092900085 12:13050557-13050579 CTATATTTGTGGAACAAGGGAGG + Intronic
1095075424 12:37915890-37915912 CTGTATGTGTGGAATCTGTGAGG - Intergenic
1095076655 12:37936977-37936999 CTTTATTTGTGGCATGTGCATGG - Intergenic
1096285597 12:50297155-50297177 CTTGATTTGTGGTATTTATGTGG - Intergenic
1097352958 12:58569130-58569152 CTTTGCTTGTGGGATTTAGGAGG - Intronic
1098536286 12:71597182-71597204 CTTTCTTTTTGGATTTAGGGGGG + Intergenic
1099257900 12:80337963-80337985 CATTATTTGGAGCATTTGGGTGG + Intronic
1100802618 12:98249387-98249409 TTGTATTTGTGGTATTTTGGGGG - Intergenic
1102698524 12:114818463-114818485 CTTTATTTGTGCAATTAATGTGG + Intergenic
1105111708 13:16627978-16628000 CTCTTTTTGTGGAATCTGCGAGG + Intergenic
1105119551 13:16756081-16756103 CTCTTTTTGTGGAATCTGCGAGG + Intergenic
1105151431 13:17276423-17276445 CTCTTTTTGTAGAATTTGCGAGG + Intergenic
1105158703 13:17395159-17395181 CTCTTTTTGTGGAATCTGCGAGG + Intergenic
1105158868 13:17397886-17397908 CTCTTTTTGTGGAATCTGCGAGG + Intergenic
1106669260 13:31887587-31887609 GTTTATGGGTGGAATGTGGGAGG - Intergenic
1107307108 13:39034427-39034449 CTTTCTTTGTAGAAGTTGGTAGG - Intronic
1108185994 13:47888977-47888999 CATTATTACTGGCATTTGGGTGG - Intergenic
1108310358 13:49183460-49183482 GATTATTTGTAAAATTTGGGTGG + Intronic
1108408897 13:50128416-50128438 CAATATTTGTGGATTTTGGCAGG + Intronic
1108923277 13:55703225-55703247 TTTTATTTGTGGAATATGGCTGG + Intergenic
1109979958 13:69894796-69894818 CTTAATTTCTGGGATTTGGTTGG + Intronic
1111898580 13:94172060-94172082 CTCTGTGTGTGCAATTTGGGGGG - Intronic
1112065702 13:95790483-95790505 CTTTATTTTGGGGATTAGGGTGG + Intronic
1113330936 13:109327134-109327156 CTATACTTGTGAAATTTGGGAGG - Intergenic
1113625421 13:111792772-111792794 CTTTGTTTGTGGAAGATGGAAGG - Intergenic
1115908327 14:38226534-38226556 CTTTAGTTGTGGTATGTGGATGG - Intergenic
1118520432 14:66576636-66576658 GTTTATTTGGGGGATTTGGTGGG + Intronic
1118937726 14:70302786-70302808 ATTCATTTCTGGACTTTGGGAGG - Intergenic
1120894343 14:89516373-89516395 GTTCATTTGTGAAATTTCGGTGG - Intronic
1121293655 14:92798410-92798432 CTTTATTTGTGGAGGATGTGGGG - Intronic
1123223369 14:106877252-106877274 CCTTATTTGTTGAATTTAGATGG + Intergenic
1124682389 15:31745509-31745531 CTTTGTTTGTGGCATTAGGTAGG - Intronic
1125126436 15:36227662-36227684 CTTTTTTTGTAGAAATGGGGGGG - Intergenic
1125453684 15:39835621-39835643 CTGTATTTCAGGAATTAGGGTGG + Intronic
1126456609 15:48869337-48869359 CATTATTTTTGAAATTTTGGAGG + Intronic
1126606024 15:50477256-50477278 TTTTATTTTTGGAATTTTAGTGG + Exonic
1133630202 16:7613180-7613202 TATTATTAGTGGAATTTGGGGGG + Intronic
1134479877 16:14609599-14609621 CTTTATTTGGCGTATTTTGGGGG + Intronic
1134878236 16:17721270-17721292 CTTTAAATGTGCAATTTGTGTGG - Intergenic
1136921764 16:34287096-34287118 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
1139066822 16:63326255-63326277 CTTAATTTTTGTAATTTTGGGGG + Intergenic
1139090185 16:63636284-63636306 TTTTATATGTGGAATATGAGTGG - Intergenic
1140233056 16:73133722-73133744 CTTTCTTTGTGGTATTTTGGGGG + Intronic
1141122652 16:81372897-81372919 TTTTATTGGAGGCATTTGGGAGG + Intronic
1141376266 16:83533573-83533595 CCTTAGTTGTGGAAGTTGTGAGG + Intronic
1142296399 16:89225768-89225790 CTGAATGTGCGGAATTTGGGAGG + Intronic
1144262061 17:13531377-13531399 CTATAATGGTGGAGTTTGGGTGG + Intronic
1149292845 17:55234102-55234124 CCTGATGTGTGGAAATTGGGAGG - Intergenic
1151027429 17:70694972-70694994 TTTTATTTCTGGAAATAGGGAGG - Intergenic
1153446699 18:5180755-5180777 TTTTATTTTTGCATTTTGGGGGG - Intronic
1154142678 18:11838890-11838912 CTATCTTTGTGGAAATTGGCAGG + Intronic
1155889780 18:31253213-31253235 CTTTCTGTGTTGCATTTGGGTGG - Intergenic
1157135453 18:45049797-45049819 ATTTAATTATGGAATTTAGGGGG + Intronic
1157751918 18:50186766-50186788 CTTTATCTGAAGAATTGGGGTGG - Intronic
1158631660 18:59120507-59120529 CTTAATTTGTAAATTTTGGGGGG + Intergenic
1159028486 18:63208096-63208118 TTTTATTTGTGCAAGTTGAGAGG + Intronic
1159289465 18:66396845-66396867 CTGGGTTTGGGGAATTTGGGAGG - Intergenic
1159936936 18:74376484-74376506 ATTTATTTGTGAAATTTAGTTGG + Intergenic
1160109406 18:76011641-76011663 TGTTATGTGTGTAATTTGGGTGG - Intergenic
1162530871 19:11235811-11235833 CTTTATATTTGGAAAGTGGGCGG - Intronic
1164337202 19:24338283-24338305 CTGTTTTTGTGGAATCTGTGAGG + Intergenic
1164339667 19:24377616-24377638 CTGTTTTTGTAGAATCTGGGAGG + Intergenic
1164364505 19:27561583-27561605 CTCTTTTTGTAGAATGTGGGAGG + Intergenic
1164364876 19:27567309-27567331 CTGTTTTTGTGGAATTTGTGAGG + Intergenic
1166346168 19:42167451-42167473 TTTTTTTTTTGGAGTTTGGGGGG - Intronic
1166882184 19:45936297-45936319 CTTGGCTGGTGGAATTTGGGGGG + Exonic
925187501 2:1859226-1859248 CTATATTTGTGGCATTTAGGTGG + Intronic
926514417 2:13823802-13823824 CTTTGTTTGTGGGAGTTAGGAGG + Intergenic
927391022 2:22595552-22595574 ATTTATTGATGGAATGTGGGTGG + Intergenic
928645636 2:33349514-33349536 GTTCATTTGTGGAGTTTGTGTGG + Intronic
929007085 2:37406366-37406388 GTTTATTATTGGAGTTTGGGAGG - Intergenic
929627650 2:43426512-43426534 ATTCATTTTAGGAATTTGGGTGG - Intronic
930496102 2:52145930-52145952 CTTTATTTGCTGCATTTGGCAGG + Intergenic
930926647 2:56826301-56826323 CTTTATTTTTGCATTTTTGGTGG + Intergenic
930984336 2:57566807-57566829 ATTTCTTTGAGCAATTTGGGAGG - Intergenic
932700379 2:73987386-73987408 CTTTATTTGGGGTAGTAGGGTGG + Intronic
933047094 2:77552911-77552933 CTTTATTTCTGTAATTTTGATGG + Intronic
933180332 2:79219511-79219533 CTTTATTTGTTAAACTTGTGAGG + Intronic
933631078 2:84659071-84659093 TGTTATTTGTGGTCTTTGGGTGG + Exonic
933863499 2:86494671-86494693 TTTTATTTGTGTAAAGTGGGTGG + Intergenic
933887343 2:86730655-86730677 CTTTATATTTGGAATTTGAAGGG + Intronic
933922832 2:87066058-87066080 CTTTATATTTGGAATTTGAAGGG - Intergenic
934334105 2:92107605-92107627 CTCTTTTTGTGGAATCTGGAAGG + Intergenic
934334649 2:92115445-92115467 CTCTTTTTGTGGAATCTGGAAGG + Intergenic
936010079 2:108919942-108919964 CTGTGTGTGTGGAATTTGAGGGG - Intronic
937915141 2:127095259-127095281 CTTTCTTTGTGGGAGGTGGGAGG + Intronic
938249166 2:129800219-129800241 CATTATTGGTGCCATTTGGGGGG + Intergenic
939690174 2:145249875-145249897 CTTAATTTGTGAAAAGTGGGAGG + Intergenic
939759773 2:146160417-146160439 CTTTAAATGTATAATTTGGGAGG - Intergenic
940123439 2:150294570-150294592 CATCATCAGTGGAATTTGGGTGG - Intergenic
940278009 2:151959711-151959733 CTTTATATTTGGAATGTGGGAGG + Intronic
941838842 2:170056551-170056573 GTTTATTTGTAGAAGTTGGTAGG + Intronic
943139480 2:183962225-183962247 TTTTATTTGAGTAATTTAGGGGG + Intergenic
943381810 2:187158905-187158927 CTTTGTTTGGGAAATTTGAGGGG - Intergenic
943859245 2:192838357-192838379 TTTTTTTTTTGTAATTTGGGGGG + Intergenic
943929386 2:193830483-193830505 CTTTATCTGTGGTATTTGGATGG + Intergenic
944067245 2:195632227-195632249 CTTTTTCTGTGAAATTTGAGTGG + Intronic
944095426 2:195962080-195962102 CTTTAGTTGTGAAATATGTGAGG + Intronic
944435020 2:199679322-199679344 CTTTATTTGTGGCAATTTTGGGG + Intergenic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
945552298 2:211235416-211235438 TTTTATTTGAGGGATTTGAGGGG + Intergenic
945766993 2:213993216-213993238 GTTTATTTATGCAATTTGTGAGG + Intronic
945977565 2:216282650-216282672 CTTGATTTGGGGCATTTGTGAGG + Intronic
947042937 2:225944684-225944706 CTATGTTTATAGAATTTGGGTGG + Intergenic
1173738589 20:45379568-45379590 CTTTTTTTGTTGTTTTTGGGGGG + Intronic
1174135455 20:48375990-48376012 CTTCTTTTGTTGATTTTGGGAGG + Intergenic
1177471841 21:21569920-21569942 CTTTATTTTGGGAAAGTGGGGGG - Intergenic
1177492387 21:21844538-21844560 CTTTATTAATGGATTATGGGAGG - Intergenic
1177821227 21:26032970-26032992 GTTCATTGGTGGAGTTTGGGAGG + Intronic
1178454487 21:32735515-32735537 CTTTATTTAGTGAATTTTGGTGG - Intronic
1178725165 21:35044985-35045007 CTTTATTAGTGGGGTTTAGGGGG - Intronic
1180656802 22:17428564-17428586 CTTTTATTGTGAAATATGGGGGG - Intronic
1182657768 22:31903630-31903652 CTTTAGGTGTGGAAGGTGGGGGG - Intronic
1182657776 22:31903653-31903675 GTTTAGTTGTGGAAGGTGGGGGG - Intronic
1182823886 22:33245386-33245408 CTTTGCTTGTTGAATTTTGGAGG - Intronic
1184532219 22:45063473-45063495 CTGTAATTGTAGCATTTGGGAGG - Intergenic
1202715941 2_KI270715v1_random:1960-1982 CTCTTTTTGTGGAATCTGGAAGG + Intergenic
1202716648 2_KI270715v1_random:12180-12202 CTCTTTTTGTGGAATCTGGAAGG + Intergenic
1202716983 2_KI270715v1_random:16949-16971 CTCTTTTTGTGGAATCTGGAAGG + Intergenic
1202728635 2_KI270716v1_random:35919-35941 CTCTTTTTGTGGAATCTGGAAGG + Intergenic
1202729297 2_KI270716v1_random:45457-45479 CTCTTTTTGTGGAATCTGGAAGG + Intergenic
949653998 3:6195444-6195466 CATTCTTTGTGGGAATTGGGCGG + Intergenic
949699212 3:6736478-6736500 CTTTAGCTGAGGGATTTGGGGGG + Intergenic
949879125 3:8648086-8648108 CTTCCTATGTGGTATTTGGGGGG - Intronic
951117733 3:18885488-18885510 CTTTATTTGAGGAACCTGTGTGG - Intergenic
951985317 3:28613354-28613376 CATTATGTGTGGATTTTGGAGGG + Intergenic
952512652 3:34072651-34072673 CCTTATTTGTGGATCTTGGGAGG - Intergenic
952840774 3:37643499-37643521 TTTTATTTTTGCAATTTGTGGGG + Intronic
953151693 3:40330910-40330932 TTTTATCTTTGGAAATTGGGTGG + Intergenic
953226211 3:41024051-41024073 CTTAATTTGTGGAGTTTAAGGGG - Intergenic
954173819 3:48826913-48826935 CTTTATTTTTGTAAGTTGAGAGG - Intronic
954772013 3:52979543-52979565 TTTAATTAGTGGAATGTGGGTGG - Intronic
954856429 3:53647709-53647731 CTTCATTTGTTGAATGTGGAGGG + Intronic
955909070 3:63841348-63841370 ATGTCTTTGTAGAATTTGGGGGG + Intronic
958218879 3:90634350-90634372 CTCTTTTTGTGGAATTTGCAAGG - Intergenic
958222892 3:90718233-90718255 CTCTTTTTGTGGAATTTGCAAGG - Intergenic
958257913 3:91346567-91346589 CTTTTTTTGTGGGAGTGGGGTGG - Intergenic
958278873 3:91629366-91629388 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958287033 3:91763254-91763276 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958287285 3:91767164-91767186 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958293905 3:91875347-91875369 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958333158 3:92518715-92518737 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958358574 3:92935875-92935897 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958363327 3:93013598-93013620 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958363692 3:93019720-93019742 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958389003 3:93433267-93433289 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958393878 3:93513105-93513127 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958407398 3:93766029-93766051 CTCTTTTTGTGGAATCTGGAAGG - Intergenic
958635286 3:96736653-96736675 CTTAGTCTCTGGAATTTGGGTGG + Intergenic
960056578 3:113280108-113280130 CTTCATCAGTGGAATTTGGGAGG + Intronic
960851060 3:122054976-122054998 CTTTGGTTGTGGAAATTGGCAGG + Intergenic
961135339 3:124504849-124504871 CTTTATTATTAGAATTTTGGTGG + Intronic
961218975 3:125184942-125184964 TTTTATTTGTGTAAGTTTGGTGG - Intronic
961426578 3:126852965-126852987 CTTTTTTTGTTGAATGTGGCTGG + Intronic
963062672 3:141237505-141237527 CCTTATTTGTAAAATTTGGGTGG + Intronic
963380992 3:144530109-144530131 GTTTATTTCTGGAAATAGGGAGG + Intergenic
964578894 3:158208231-158208253 ATTTATTTTTAAAATTTGGGGGG - Intronic
965564973 3:170105824-170105846 ATTTATTACTGGAATTAGGGTGG + Intronic
967541298 3:190670826-190670848 CTTTAATTGTAGACTTTGGGTGG - Intergenic
967756129 3:193171032-193171054 CTTTATTTTTATAATTTGGCAGG - Intergenic
970093049 4:12431099-12431121 CTTTATTTGTAATAATTGGGGGG - Intergenic
972553244 4:40153326-40153348 CAGTATTTGTGGATTTTGGATGG + Intronic
972724970 4:41738917-41738939 CTTTCTTTGTGCAACTTGGAGGG + Intergenic
974208417 4:58737884-58737906 CTTCATTTCTGTGATTTGGGAGG - Intergenic
974315606 4:60276129-60276151 GTTTATTTGTGGAATCTTTGAGG + Intergenic
977639185 4:99335871-99335893 CTTTATATGTAGATATTGGGTGG - Intergenic
978326042 4:107557102-107557124 CTTTATTTAAAGAATTTGGATGG + Intergenic
978365880 4:107981114-107981136 CTTTATTTGAGCAATTTTAGTGG + Intergenic
978593386 4:110350996-110351018 CTTTATTTAAGCAGTTTGGGAGG + Intergenic
979347735 4:119608557-119608579 TTTTATTTGTTCATTTTGGGAGG - Intronic
980156987 4:129119137-129119159 TTTTATTTGTAGAATAGGGGAGG - Intergenic
981637658 4:146899075-146899097 CTTTATTGGTGAGGTTTGGGGGG - Intronic
982525921 4:156478130-156478152 CTTATTTGTTGGAATTTGGGTGG - Intergenic
983698657 4:170564675-170564697 TTTTATAGGTGGGATTTGGGAGG + Intergenic
984308289 4:178022972-178022994 ATTTTTTTCTGGAATTTTGGGGG + Intergenic
984328424 4:178283558-178283580 GTATATTTGTGCACTTTGGGAGG - Intergenic
986065983 5:4234562-4234584 CTTTATTTGTTTAGTTTTGGCGG - Intergenic
987106368 5:14643716-14643738 CTTTATTTTTAAAATTTGTGTGG + Intergenic
989316708 5:40088877-40088899 GTTTATTCCTGGACTTTGGGAGG - Intergenic
989837695 5:46013986-46014008 CTGTATTTGTAGAATCTGGAAGG + Intergenic
989845937 5:46141169-46141191 CTGTATTTGTAGAATCTGTGAGG + Intergenic
989853813 5:46252517-46252539 CTGTATTTGTAGAATCTAGGAGG - Intergenic
990136640 5:52652962-52652984 ATTTTTTTGTGGAATTTGAGGGG - Intergenic
990160645 5:52936383-52936405 CTTTAATTCTGGAATTCTGGAGG - Intronic
996117396 5:119633639-119633661 TGTTATTTGTGGAATGTGGGAGG - Intronic
996128192 5:119750887-119750909 ATTTGTTTGTGGAATTAAGGGGG + Intergenic
997129836 5:131264913-131264935 CTTTTTTAGGGGAATTTTGGGGG + Intronic
998224991 5:140320106-140320128 TTTTATTGGTGGAATATGGATGG + Intergenic
998773081 5:145568102-145568124 CTTTCTTTTTGGTCTTTGGGAGG - Intronic
999499881 5:152136234-152136256 CTGTGTTTGGGGAATGTGGGTGG - Intergenic
999671540 5:153962903-153962925 TTTAATATGTGGATTTTGGGGGG + Intergenic
1000687893 5:164275201-164275223 GTTTATTTTTGGAAGTTGGTTGG + Intergenic
1001133784 5:169085537-169085559 CTGGATTTGGGGAATTGGGGTGG - Intronic
1004227835 6:13803541-13803563 CTTAATTAATGGAATTTGTGTGG + Intronic
1005631757 6:27714744-27714766 GTTTATCTTTGGAATGTGGGGGG - Intergenic
1007289730 6:40776303-40776325 CTTTATGTGTTGAGGTTGGGGGG + Intergenic
1008682041 6:53882981-53883003 GTTTTTTTGTGAAGTTTGGGTGG + Intronic
1008997358 6:57674202-57674224 CTTTTTTTGTGGGAGTGGGGTGG + Intergenic
1009136748 6:59548427-59548449 CTTTTTTTGTAGAATTTGCAAGG + Intergenic
1009320548 6:62283287-62283309 GTTTATTTGGGGTTTTTGGGGGG - Intronic
1009569121 6:65358506-65358528 CTTTATTTCTGAAATTAAGGAGG + Intronic
1010109397 6:72207793-72207815 TTTTCTCAGTGGAATTTGGGGGG - Intronic
1010355559 6:74928475-74928497 CCTTATATGGGGAACTTGGGTGG + Intergenic
1010457279 6:76072072-76072094 TTTTATTTGTTGAATTTCGGTGG + Intronic
1010726149 6:79336207-79336229 CTTTATTTTTAGAATTTCAGTGG - Intergenic
1011146383 6:84222205-84222227 CTTTATTTGTGGCATTTCGGAGG - Intronic
1013005201 6:106066132-106066154 CTTTATTTGTCCCATTTGGAAGG - Intergenic
1013358659 6:109372195-109372217 TTATATTAGTAGAATTTGGGAGG - Intronic
1016651078 6:146461859-146461881 CTTGATTTGTGGATTTGAGGAGG + Intergenic
1017351406 6:153446670-153446692 GTTCATTTCTGGACTTTGGGAGG + Intergenic
1020792362 7:12642639-12642661 CTTTGTTTGTGGCATGTGGCAGG - Intronic
1020834958 7:13137530-13137552 CTTTATTTGTGGACTATGATTGG + Intergenic
1021111978 7:16706008-16706030 CTTAATTAGAGGAATCTGGGAGG + Intronic
1021628195 7:22615386-22615408 CAAGATTTTTGGAATTTGGGTGG + Intronic
1023369604 7:39499853-39499875 TTTGCTTTTTGGAATTTGGGAGG + Intergenic
1024178161 7:46861879-46861901 CTTCATTTCTGGGATTTAGGAGG + Intergenic
1024413620 7:49077759-49077781 CTATATTTGTGTACTTTTGGAGG - Intergenic
1027683158 7:81245792-81245814 ATTTCTTTGTGCTATTTGGGAGG + Intergenic
1027897090 7:84058880-84058902 TTTTCTTTGTGGACTTTGGGTGG + Intronic
1028336782 7:89667795-89667817 CTTCATTTCTGGATTTTAGGGGG - Intergenic
1030186212 7:106764657-106764679 GTTGCTTTGTGGAATTTGGTGGG - Intergenic
1030988034 7:116265152-116265174 AATTCTTTGTGGAATTTGGCAGG + Intergenic
1031200680 7:118681081-118681103 ATTTATTTGTGTAATTTGGCGGG - Intergenic
1032528451 7:132598941-132598963 CTTTATATGTGGCATTAGGTAGG + Intronic
1032629691 7:133635313-133635335 TGTTATTTGTGGGATTTGTGGGG + Intronic
1032934463 7:136712944-136712966 CTTTATTGGGGGAATTTAGAAGG + Intergenic
1035441562 7:158906014-158906036 CTCTGTTTGTGGAATTTTTGTGG + Exonic
1036451200 8:8869492-8869514 CTTTATTTCTTAAATTTGGAAGG - Intronic
1037244613 8:16818754-16818776 TTTTTTTTGTGGAAATTGGCAGG + Intergenic
1037338090 8:17811820-17811842 CTTTTTTTGTTGTATTTGTGTGG + Intergenic
1037661995 8:20935689-20935711 CTTTATTTGTAGAATACAGGTGG + Intergenic
1040119357 8:43664711-43664733 CTCTTTTTGTGGAATTTGTGAGG + Intergenic
1040125452 8:43732457-43732479 CTTTTTTTGTGGAATCTGCAAGG + Intergenic
1040128060 8:43761324-43761346 CTTTTTTTGTAGAATTCGTGAGG + Intergenic
1040128444 8:43765846-43765868 CTCTTTTTGGGGAATTTGTGAGG + Intergenic
1040283201 8:46080839-46080861 CTTTTTTTGTAGAATCTGTGAGG + Intergenic
1040320756 8:46297999-46298021 CTCTTTTTGTAGAATTTGTGAGG - Intergenic
1041828152 8:62121844-62121866 CTTTCTCTGTGGTAGTTGGGTGG + Intergenic
1041919170 8:63164060-63164082 ATTTAATTGTGAAATTTGGAGGG - Intergenic
1043950087 8:86298975-86298997 CCTTATTGGTGGAATGGGGGTGG + Intronic
1046458334 8:114499266-114499288 CTTTATTTTTGTAATTTTTGTGG - Intergenic
1047532562 8:125690569-125690591 CTATAATTGAGGATTTTGGGAGG - Intergenic
1050360339 9:4824637-4824659 ATTTATTTGTGGAATGTGTGCGG - Intronic
1051406640 9:16744376-16744398 CATTATTTGTAGGATTTGGGAGG - Intronic
1051804554 9:20977509-20977531 CTTTATTTTTGGAGTTAGGGTGG - Intronic
1052291223 9:26843832-26843854 CTTTAATTTTGGAATGGGGGTGG - Intronic
1055787964 9:79891449-79891471 TTTAATTTGTGAAATTTGGGAGG + Intergenic
1055797488 9:79990766-79990788 CTTTATTTGTTGAGGGTGGGTGG + Intergenic
1056771161 9:89479227-89479249 CTTGATTGGTGGAATGTGGTGGG - Intronic
1058099418 9:100902463-100902485 CTTTATTGTGGGAATTTGGCAGG + Intergenic
1058125580 9:101190567-101190589 GTTTATTTGTGGCAGTTGGTGGG + Intronic
1203339160 Un_KI270303v1:1559-1581 CTCTTTTTGTGGAATTTGCAAGG - Intergenic
1186698713 X:12066671-12066693 CATTATTTGGGGAACTTAGGTGG - Intergenic
1187696893 X:21931641-21931663 CTTTATTTTTTCAATTTGGAAGG + Intergenic
1188208875 X:27394450-27394472 ATTTATATGTGAAATATGGGAGG - Intergenic
1189712297 X:43826182-43826204 CTTTATTTGTGGAATTTGGGTGG + Intronic
1189980325 X:46504186-46504208 CTTTATTGGTGGATATTTGGTGG - Intronic
1191262956 X:58348013-58348035 CTGTTTTTGTAGAATCTGGGAGG + Intergenic
1191570415 X:62608874-62608896 CTTTTTTTGTGGAATCTGCAAGG + Intergenic
1191582969 X:62785863-62785885 CTTTTTTTGTAGAATCTGAGAGG - Intergenic
1192129216 X:68532080-68532102 CCTTATTTGTCTAATTTTGGAGG + Exonic
1193358206 X:80548252-80548274 CATTTTTTGTGGAATTTGTAGGG + Intergenic
1194251916 X:91586591-91586613 CTCTATTTGTAGTTTTTGGGGGG - Intergenic
1197905523 X:131421034-131421056 ATTTAGTGGTGGAATTTTGGAGG + Intergenic
1199836943 X:151600392-151600414 CCTTATTTGTGGAAATTCTGTGG + Intronic
1200570846 Y:4827829-4827851 CTCTATTTGTAGTTTTTGGGGGG - Intergenic