ID: 1189712442

View in Genome Browser
Species Human (GRCh38)
Location X:43827383-43827405
Sequence GTCTAGTACCTTTGTAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189712442 Original CRISPR GTCTAGTACCTTTGTAAGGA GGG Intronic
901946644 1:12709621-12709643 GTCTAAGACCTTTGATAGGAAGG + Intergenic
908733690 1:67253643-67253665 TCCTAATACCCTTGTAAGGAAGG + Intronic
909259275 1:73466125-73466147 TTTGAGTATCTTTGTAAGGAAGG + Intergenic
909746996 1:79109499-79109521 GTCTAGAGCCTTTGCAAGGATGG - Intergenic
917624656 1:176833418-176833440 GTCTTGGCCCTTTGTAAGGTAGG - Intronic
918099444 1:181360970-181360992 CTCTAGTACCTTTGAAGGGTGGG + Intergenic
919872242 1:201830833-201830855 GTCTGGCACCTTTGTATGAAAGG + Intronic
920266443 1:204727198-204727220 TTCTCCTGCCTTTGTAAGGATGG + Intergenic
924877066 1:248117124-248117146 GTCTAAAACCTTTGATAGGAAGG + Intergenic
1064386694 10:14899938-14899960 TTCTAGTAACTTTGTACGGTAGG + Intronic
1067555025 10:47263388-47263410 GGCTAGTGGCTTTGTAAAGATGG + Intergenic
1068761782 10:60720128-60720150 GTGTATTATCCTTGTAAGGAAGG - Intronic
1069418307 10:68222392-68222414 GTGTACTACCCTTCTAAGGAAGG - Intergenic
1075268393 10:121026070-121026092 GTCAGGTACCTCTGGAAGGAGGG - Intergenic
1078349073 11:10577730-10577752 ATCTGGTCCCTTTCTAAGGAGGG - Intronic
1084860327 11:72013900-72013922 GTCTTGTACCTTGGTGCGGAAGG + Exonic
1091187406 11:133658698-133658720 GTCTAGTGCCCTTCTGAGGATGG - Intergenic
1093105029 12:15075846-15075868 GTCTAGTACTCTAGCAAGGATGG - Intergenic
1093830146 12:23746089-23746111 GTTTAGTACTTTTGTAAAAATGG - Intronic
1097352830 12:58567321-58567343 GTGTATTACCTTTGTAATAAGGG - Intronic
1098910611 12:76204827-76204849 GTCTGGCACCTTGGCAAGGATGG - Intergenic
1100253303 12:92854845-92854867 GTCTAGTCACTTTCTCAGGATGG - Intronic
1100273972 12:93054221-93054243 GTCTAGTAGATTTCTCAGGATGG + Intergenic
1102188959 12:110971436-110971458 GTCTGGTACCTTGCTAGGGATGG + Intergenic
1105352076 13:19625020-19625042 GACTAGTGGCTTTGTAAGGGGGG - Intergenic
1111611590 13:90614401-90614423 GTCTAGTACATTAGTAGGTAAGG + Intergenic
1113525250 13:110969509-110969531 GTCTAAGACCTTTGATAGGAAGG - Intergenic
1114197931 14:20495455-20495477 GTCTGCTGGCTTTGTAAGGAAGG - Intergenic
1118118298 14:62806546-62806568 GTCTGCTTCCTTTGTAGGGAGGG - Intronic
1122458712 14:101878146-101878168 GATTAGTGTCTTTGTAAGGAGGG - Intronic
1125865704 15:43046273-43046295 GTCTACTACATTTGTGAGTATGG + Intronic
1131581397 15:93647070-93647092 GACTAGTATCCTTATAAGGAGGG - Intergenic
1151017489 17:70573458-70573480 TTCTAGCATCTTTGTAAGTAAGG - Intergenic
1151624130 17:75266007-75266029 ATGTAGTTCCTTTGTAAGGGTGG + Exonic
1154370962 18:13762849-13762871 TTCAAGTATCTTTGTAATGAAGG + Exonic
1156788566 18:40944996-40945018 GTCTATAAACTTCGTAAGGATGG + Intergenic
1158639457 18:59191069-59191091 GTTTACTACCTGTGTCAGGAAGG + Intergenic
1158687824 18:59630591-59630613 GTCTGGTATCTTTGCAAGGATGG + Intronic
1159097960 18:63926346-63926368 GACTAGTCTCTCTGTAAGGAGGG - Intronic
1167020600 19:46872533-46872555 CTCTAGTACCTTTGAAGGTAAGG + Intergenic
933034209 2:77371839-77371861 GTCAAGAACCTTTGAAGGGAAGG + Intronic
933389724 2:81654360-81654382 GTCTAAGACCTTTGATAGGAAGG + Intergenic
933393816 2:81706528-81706550 ATTTAGTACATTTGTAAGGTAGG + Intergenic
939508701 2:143080060-143080082 GTCTAGTACCTTGGTGCGGATGG - Intergenic
941949075 2:171134339-171134361 ATATATTACCTTTGTAAGTAAGG + Intronic
1170787805 20:19482445-19482467 GTCTAAGACCTGTGCAAGGATGG - Intronic
1178304554 21:31480638-31480660 TTCTATCACCTTTGGAAGGAAGG + Intronic
1184336544 22:43856531-43856553 GTTTAGTAGCTTGGTAGGGAGGG - Intronic
950846407 3:16020037-16020059 GTCTAAGACCTTTGATAGGAAGG + Intergenic
951857483 3:27213940-27213962 GTCTAGAACCTTTTAAAGGTAGG + Intronic
952670770 3:35965245-35965267 GATTATTCCCTTTGTAAGGAAGG - Intergenic
955419682 3:58724067-58724089 GTTTAATCCCTTTGAAAGGAGGG + Intronic
961582663 3:127895202-127895224 GTCTAAGACCTTTGATAGGAAGG - Intergenic
961583406 3:127902194-127902216 GGCTAGTGTCCTTGTAAGGAGGG - Intergenic
962319728 3:134380469-134380491 GTCTAGTCACTTTGTGAGAATGG + Intergenic
962695626 3:137944616-137944638 GACCAATACCTTTGAAAGGAAGG + Intergenic
964395101 3:156237033-156237055 GGCTAGGCTCTTTGTAAGGACGG + Intronic
966306019 3:178535691-178535713 GTTAAGTACCTTTGCAAGTAAGG - Intronic
972549086 4:40110973-40110995 GTCTAATTCCTTTGGAAGAAAGG + Intronic
972832989 4:42835600-42835622 GTCTAGCACCTTGGTGAAGATGG - Intergenic
980885137 4:138754388-138754410 GTCTAGTAGCATTGGAAGAAAGG + Intergenic
983374299 4:166904524-166904546 TTCTAGTAACATAGTAAGGATGG + Intronic
984220661 4:176970788-176970810 GCCTAGTAACTGTGTCAGGAAGG - Intergenic
989613799 5:43319693-43319715 GTCTAAGACCTTTGATAGGAAGG + Intergenic
991152724 5:63389952-63389974 CTCTAATACCTTTGTCAAGAAGG + Intergenic
992522333 5:77567481-77567503 GTCAAGTAACTCTGTGAGGATGG - Intronic
1000634128 5:163624153-163624175 GTCAAGGACCTGAGTAAGGAGGG + Intergenic
1000961509 5:167606445-167606467 GATTAGTGCCTTTGTAAGAAGGG - Intronic
1001251707 5:170151948-170151970 GACTAGTACCCTTGTAAGAAGGG + Intergenic
1005108352 6:22250418-22250440 GTGTTCTACCTTTGAAAGGACGG + Intergenic
1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG + Intronic
1008064124 6:47029287-47029309 TTCTAGTAAGTTTGTAATGATGG - Intronic
1008404263 6:51101171-51101193 GTCTATTAAGTTTTTAAGGAAGG - Intergenic
1012118114 6:95330632-95330654 GTCTGGTACCTTTTTAAGTCTGG - Intergenic
1012514695 6:100045181-100045203 GTCTAGTTGCTTTATTAGGATGG - Intergenic
1013476540 6:110512168-110512190 GATTAGTACCTTTGGAAGAAGGG + Intergenic
1016411943 6:143792688-143792710 GTCTGGTGTCTTGGTAAGGAAGG + Intronic
1018315063 6:162548622-162548644 GTCCATTTCCTTTGGAAGGATGG + Intronic
1018900953 6:168051484-168051506 GATTAGTGCCTTTGTAAGGGGGG + Intergenic
1027766843 7:82354565-82354587 CTCTATTTCCTTTGTAATGAAGG + Intronic
1031358905 7:120822887-120822909 GTCTTGAACCTTTGTAGGAAAGG - Intronic
1039400830 8:37267638-37267660 GTCTGGTGCCTTTGTATGAAAGG + Intergenic
1040002637 8:42592122-42592144 TTCTATTACCTGTGTAAGCAAGG + Intergenic
1043160819 8:76844425-76844447 ATCTAGTACCTTGTAAAGGATGG + Intronic
1046646065 8:116787017-116787039 GACTAGTACCCTTGTAAAAAAGG + Intronic
1051806705 9:21001974-21001996 ATCTAGTACTTTTGTAACAATGG + Exonic
1056104036 9:83329213-83329235 GTATAGCACCTTTCTTAGGAAGG - Intronic
1056414647 9:86364783-86364805 GTCTAAGACCTTTGATAGGAAGG + Intergenic
1058523422 9:105834451-105834473 ATCTAATATCTTTTTAAGGAGGG - Intergenic
1189712442 X:43827383-43827405 GTCTAGTACCTTTGTAAGGAGGG + Intronic
1190026022 X:46923914-46923936 CTCTAGTACCTGTCTAAGTAAGG - Intronic
1193428215 X:81367187-81367209 GTCTAGTAAATTTGTAAAAATGG + Intergenic
1198830037 X:140740696-140740718 GTATGGAACCTTTGTAAGCAAGG - Intergenic