ID: 1189715913

View in Genome Browser
Species Human (GRCh38)
Location X:43866039-43866061
Sequence GGAAACAAGGCATCCGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189715910_1189715913 -7 Left 1189715910 X:43866023-43866045 CCTAGGAAGAGCCACGGGAAACA 0: 1
1: 0
2: 0
3: 18
4: 158
Right 1189715913 X:43866039-43866061 GGAAACAAGGCATCCGAAGTAGG 0: 1
1: 0
2: 2
3: 5
4: 90
1189715909_1189715913 -6 Left 1189715909 X:43866022-43866044 CCCTAGGAAGAGCCACGGGAAAC 0: 1
1: 0
2: 1
3: 11
4: 101
Right 1189715913 X:43866039-43866061 GGAAACAAGGCATCCGAAGTAGG 0: 1
1: 0
2: 2
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189715913 Original CRISPR GGAAACAAGGCATCCGAAGT AGG Intronic
908606733 1:65805559-65805581 GGAAACAAGGAATCTGCTGTAGG - Intronic
910125521 1:83837738-83837760 GGAAACAGGCCATCCTAAGAAGG + Intergenic
915290080 1:154877674-154877696 GGAAAGAAGGCATGGGAAATGGG + Intergenic
915454817 1:156033165-156033187 GAAAACAAGGCATCCGACTCTGG + Intergenic
918134126 1:181655641-181655663 GGAAACAAGGGATTCGATGGAGG + Intronic
918998038 1:191788539-191788561 GTATACATGGCATCTGAAGTAGG - Intergenic
921404674 1:214765490-214765512 GGAAACAAGCCAGCTGATGTGGG - Intergenic
1065543168 10:26790731-26790753 GCAAACAAGGCCTCTGAATTTGG + Intronic
1068268947 10:54694747-54694769 GGAAACAGGGAAGCTGAAGTGGG - Intronic
1069895661 10:71678775-71678797 GGAAAGAAGGCACCTGGAGTGGG - Intronic
1070282985 10:75063396-75063418 GGAAAACAGGCATCTGAGGTAGG - Intergenic
1073289875 10:102408338-102408360 GCAAACCAGGCATCCCAACTGGG + Intronic
1074821613 10:117183577-117183599 GGAAACAGGACATCCTAAGATGG + Intergenic
1076597735 10:131636253-131636275 GGAAACACGGCCCCAGAAGTCGG + Intergenic
1080738231 11:35038512-35038534 GGAAAAAAGGCATCAGAAAAGGG + Intergenic
1086362319 11:86071440-86071462 GGAACTAAGGCAACAGAAGTGGG - Intergenic
1089861444 11:121593565-121593587 GGAAACAAGGAATCTAAACTGGG - Intronic
1091419142 12:319923-319945 GCAAATAAGGTATCAGAAGTGGG + Intronic
1092519677 12:9255985-9256007 TGAAAACAGGCATCTGAAGTAGG + Intergenic
1094719566 12:33049602-33049624 GGAAACAAGAAATCCAAATTAGG + Intergenic
1097336298 12:58387498-58387520 GGAAAGAAGGCAAAGGAAGTGGG - Intergenic
1104203543 12:126615076-126615098 GGTATCAAGGCACCCCAAGTTGG - Intergenic
1104480464 12:129103392-129103414 GGAAGCCAGGCCTCCGAGGTGGG - Intronic
1108266054 13:48709782-48709804 GGAAACAAGGAATCCAACGCAGG + Exonic
1113831082 13:113296676-113296698 GGAAATAAGGGATCTGAAATGGG - Intergenic
1118917152 14:70117192-70117214 GGACACAGGGCATCCTAAGAGGG - Intronic
1119134790 14:72207361-72207383 GGAAACTAGGCATTTGAAATGGG + Intronic
1127133523 15:55894792-55894814 GGAAAGAAGGAATCTGAAGCAGG + Intronic
1129809913 15:78501909-78501931 TGAAACAAGTCATCGGAAGCTGG + Intergenic
1131429248 15:92373346-92373368 GGGAACTAGGCATCAGAATTAGG - Intergenic
1135634311 16:24060929-24060951 TTAAACAAGGCATCTTAAGTCGG - Intronic
1137913684 16:52405143-52405165 GGAAAGATGGCATCTGAAGAAGG + Intergenic
1140185226 16:72763703-72763725 GGAAACCAGGTGTCCGAAATAGG - Intergenic
1140189858 16:72806143-72806165 GGAAACAAGGAGGCCAAAGTGGG - Intronic
1142686694 17:1581240-1581262 GGCAACAAGGCATTTGAGGTGGG - Intronic
1147637181 17:41971247-41971269 GGAAGCAAGTCATGGGAAGTGGG - Intronic
1150903724 17:69314611-69314633 GTAAACAAGGCATGTGAAATAGG + Intronic
1153360204 18:4186179-4186201 GGAAACTATGCATCCGAAAAAGG - Intronic
1156042726 18:32841397-32841419 GGAAAAAAGGCATCTGAAAAAGG - Intergenic
1157464690 18:47932858-47932880 GGAAACAAGGCAGAGGAGGTGGG - Intergenic
1161516552 19:4699793-4699815 GGAAACAGCCCGTCCGAAGTTGG + Intronic
1161879916 19:6941816-6941838 GGGAACAAGGCATCTGGAGAAGG - Intergenic
1164584336 19:29456923-29456945 GGAAACAAGACCTCTAAAGTTGG - Intergenic
1166669338 19:44700722-44700744 GAAAACAAGGCCTCCGAAGTGGG + Intronic
1167027348 19:46930378-46930400 GGGAACCAGGCATCGGAACTCGG - Intronic
926508391 2:13743261-13743283 GGAAACAAGGCCTCTGAAGTGGG + Intergenic
927509096 2:23633143-23633165 GGAAACAAGGCTTCAGATGAAGG + Intronic
929824660 2:45300812-45300834 GGCAACAAGGCTTCCCATGTAGG + Intergenic
931945972 2:67307760-67307782 GGAGACAAGCCATTCTAAGTGGG - Intergenic
935867858 2:107410672-107410694 GGAAACAAGGCAATTGAGGTAGG - Intergenic
939009822 2:136832835-136832857 AGAAAGAATGCATCCCAAGTCGG - Intronic
939673560 2:145043586-145043608 GGAAACAAGACAGCTGATGTGGG - Intergenic
941164285 2:162068799-162068821 GGAATGAAGGCATCCACAGTAGG + Intronic
941493630 2:166173736-166173758 GGAAACAAGGCTTCCAAAGAAGG - Intergenic
942561425 2:177224006-177224028 GGAAACAAGCCATGGGAAATAGG + Intergenic
1178895898 21:36556573-36556595 GAAAACAATGCATCCTCAGTGGG + Intronic
1178912739 21:36688955-36688977 GGAAACAAAGTATCCTAAATAGG - Intergenic
952638601 3:35562962-35562984 AGAAACAAGGCATTAGAAATTGG + Intergenic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
954680795 3:52344903-52344925 GGAAACAATGCTTCAGCAGTAGG + Intronic
960171235 3:114463571-114463593 GAAAACATAGCATCCGAAGCTGG + Intronic
964185684 3:153939983-153940005 TGAAACAAGGAATCCTAACTTGG - Intergenic
970648689 4:18153362-18153384 GAAAAAAAGGCATCCAAATTGGG + Intergenic
976286757 4:83378116-83378138 GAAAACATGGCACCAGAAGTTGG + Intergenic
979867333 4:125773021-125773043 AAAAACAGGGCATCTGAAGTGGG - Intergenic
980471762 4:133262403-133262425 GGGAACAAGGCCTCTGAAATGGG - Intergenic
981632966 4:146842498-146842520 GGAAACAAAGCATCCAAATATGG - Intronic
988864120 5:35316123-35316145 GGAATCAAGGCAAAAGAAGTTGG + Intergenic
993448784 5:88047670-88047692 GGAAAGAAAGCTTCTGAAGTAGG + Intergenic
998896417 5:146804872-146804894 AGAAACAAGGCAGCCTATGTGGG + Intronic
1001600968 5:172928098-172928120 GGTAACATGTCATCCGACGTCGG + Intronic
1002671974 5:180875010-180875032 GGAAAGGAGGCATACGAAGAGGG - Intergenic
1002770079 6:282901-282923 GGAAGCAAGGCATCCTTACTTGG + Intergenic
1002856748 6:1044663-1044685 GGAGGCAAGGCAGACGAAGTTGG + Intergenic
1002877419 6:1223846-1223868 GGAAACAAGGCTTTCGCGGTCGG + Intergenic
1004857213 6:19763622-19763644 GGAAAGAAGCCATCTGAGGTTGG + Intergenic
1007210427 6:40189462-40189484 GGAACCAAGGCTTGAGAAGTAGG + Intergenic
1012956564 6:105576937-105576959 AGAAACAGGGGATCTGAAGTGGG - Intergenic
1013517673 6:110903308-110903330 GGAGACAAGGCAGCCGAAGGTGG - Intergenic
1014133315 6:117859744-117859766 GGGAACAAGGCCTTTGAAGTGGG - Intergenic
1016379441 6:143459761-143459783 GGAAACAAGGCTGCAGAAGTAGG + Intronic
1018145608 6:160884405-160884427 GGGAACAAGGCCTTTGAAGTGGG + Intergenic
1025021763 7:55485911-55485933 GGAGACAAGGGATCTGAAGGAGG + Intronic
1027822536 7:83065303-83065325 GGAAAAAAGCCATACAAAGTGGG - Intronic
1031259529 7:119500801-119500823 GTTAACAAGGCATCTGAAATAGG - Intergenic
1037356266 8:18022934-18022956 GGAAACAAGTCATCCTTATTTGG + Intronic
1046175617 8:110571410-110571432 GGAAACAAAGCATACAAATTAGG - Intergenic
1047337965 8:123954274-123954296 GAAGACAAGGCATCAGAAGGGGG - Intronic
1050543826 9:6692855-6692877 GGGAACAAGGCCTCTGAAGTGGG - Intergenic
1053045438 9:34912205-34912227 GGAAAAAATGCCTCTGAAGTAGG + Intergenic
1053075249 9:35127458-35127480 GGGAACAAGGCCTCTGAAGTGGG + Intergenic
1056626115 9:88254755-88254777 GGACATAACGCATCAGAAGTTGG + Intergenic
1057387572 9:94617798-94617820 GGACACAAGGCAATCGATGTTGG + Exonic
1058841264 9:108911874-108911896 GGAAACAAAGCAACACAAGTGGG + Intronic
1187445385 X:19356346-19356368 AGAAACAAGGTTTCTGAAGTTGG + Intronic
1189715913 X:43866039-43866061 GGAAACAAGGCATCCGAAGTAGG + Intronic
1192477371 X:71454570-71454592 GGAAACAGGGGATGCGGAGTTGG - Intronic
1196995446 X:121377812-121377834 GGAACCAAGGCATCTAAACTAGG - Intergenic