ID: 1189716419

View in Genome Browser
Species Human (GRCh38)
Location X:43871144-43871166
Sequence TTATCCTGGATTGAAGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189716415_1189716419 15 Left 1189716415 X:43871106-43871128 CCTACAGTGAACTCTCAGGCTAA 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1189716419 X:43871144-43871166 TTATCCTGGATTGAAGCAAGAGG 0: 1
1: 0
2: 2
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189716419 Original CRISPR TTATCCTGGATTGAAGCAAG AGG Intronic
900700749 1:4047363-4047385 TTCTTCTTGTTTGAAGCAAGTGG + Intergenic
900827610 1:4939203-4939225 GTGGCCTGGATTGGAGCAAGTGG - Intergenic
901147775 1:7078659-7078681 TTATCATTGTTTGTAGCAAGAGG - Intronic
901473109 1:9471274-9471296 CTCTCCTGGGTTGAAGCCAGTGG - Intergenic
902774968 1:18668859-18668881 TTGTCCTGGTTTGAGGCAGGCGG + Intronic
903989491 1:27256258-27256280 TTCACCTGGAGTGTAGCAAGGGG - Intronic
904944151 1:34186998-34187020 GTAGCCAGGATCGAAGCAAGGGG + Intronic
906783008 1:48589370-48589392 ATGTCCTGGCTTGAAGCAATGGG + Intronic
910724174 1:90321235-90321257 CTATCCTGAATTGAGGCAAAGGG + Intergenic
911259248 1:95666825-95666847 TTATACCAGATTGAGGCAAGTGG - Intergenic
916120263 1:161523322-161523344 ATGTTCTGGATTGAAGAAAGTGG + Intronic
916130026 1:161604975-161604997 ATGTTCTGGATTGAAGAAAGTGG + Intronic
916856759 1:168757987-168758009 TTGTCCTGAGTTGAGGCAAGGGG - Intergenic
919759515 1:201088551-201088573 TAATTCTGGATTGGAGCCAGGGG + Intronic
1063617230 10:7610912-7610934 ATATCCAGGAATGAAGGAAGAGG + Intronic
1063758556 10:9044557-9044579 TTATGCTGCATTGGAGGAAGTGG - Intergenic
1064777796 10:18798528-18798550 TTTCCCAAGATTGAAGCAAGAGG + Intergenic
1064847689 10:19673673-19673695 ATAGCCTAGATTGAAGCATGTGG + Intronic
1064956129 10:20912568-20912590 TTATACTGGATTCATGAAAGTGG - Intronic
1068922229 10:62496647-62496669 TTATCCAGTGTTGAAACAAGAGG - Intronic
1070470448 10:76774148-76774170 TTATCCTGGATTTATTCTAGTGG + Intergenic
1074053360 10:109899886-109899908 TTCTCCTGCTTTGAGGCAAGTGG + Intronic
1075385105 10:122049885-122049907 TTATCCTGGAGTGAAAGAAAAGG + Intronic
1075569127 10:123526528-123526550 TGATCCTGAATTGAGGCAAAAGG + Intergenic
1075779756 10:125009547-125009569 TCATGCTGGATTGCAGAAAGCGG - Intronic
1076079383 10:127565035-127565057 TTGTCCAGGATTGAAACAATGGG + Intergenic
1076399960 10:130176005-130176027 CTCTCATGGATTGAGGCAAGAGG - Intronic
1079520496 11:21320781-21320803 TCATCCTGGACAGCAGCAAGTGG - Intronic
1088685559 11:112281781-112281803 ATGTCCTGGAGTGCAGCAAGTGG - Intergenic
1089417214 11:118302191-118302213 TTATCCTGAATTGAGCAAAGGGG - Intergenic
1089725096 11:120470272-120470294 CTATCCTAGATTGCTGCAAGAGG - Intronic
1094689745 12:32756880-32756902 TCATCCTGAATTGAGGCCAGGGG + Intergenic
1095615447 12:44182735-44182757 TTAACCTGAATTTCAGCAAGTGG + Intronic
1097068733 12:56339408-56339430 AGATCCTGGAATGAAGGAAGAGG - Exonic
1098241168 12:68468491-68468513 TTCTCCTTGAGTCAAGCAAGAGG - Intergenic
1099637683 12:85235502-85235524 TTGTCCTAGCTTGAGGCAAGAGG + Intronic
1104883444 12:132088531-132088553 TTATCCTGGAAGGAAGGAAGAGG - Intronic
1104883460 12:132088621-132088643 TTATCCTGGAAGGAAGGAAGAGG - Intronic
1106125124 13:26895069-26895091 TTTTCCTGTATTGAAGCAAGTGG + Intergenic
1110685516 13:78368417-78368439 TTATACTTGATTGCAGCAAAAGG - Intergenic
1112705622 13:102066125-102066147 ATATCCTGGTTTTAAGCAGGAGG + Intronic
1116054623 14:39848250-39848272 GTATTCGGGATTGGAGCAAGAGG + Intergenic
1116967833 14:51032506-51032528 TTGTCCAAAATTGAAGCAAGGGG - Intronic
1117385047 14:55203046-55203068 TTATCCATGTTTTAAGCAAGTGG - Intergenic
1118160644 14:63286400-63286422 TTATCCAGGTTTGAAGGATGAGG + Intronic
1118474385 14:66102999-66103021 TTATCCTTAATTACAGCAAGTGG + Intergenic
1122034105 14:98935109-98935131 CTGTCCTGGATTGAGACAAGGGG + Intergenic
1123871454 15:24578872-24578894 TTATTCCGGATTTTAGCAAGGGG + Intergenic
1126850510 15:52794205-52794227 GTATCAAAGATTGAAGCAAGGGG - Intergenic
1128467317 15:67923720-67923742 TTATCTTGCCTTGAAGCCAGAGG - Intergenic
1129885269 15:79032727-79032749 GTGTCCTGAATTGAAGCAGGAGG - Intronic
1130342180 15:83008943-83008965 ATATCCTGGATTTAGGCAACTGG + Intronic
1132393951 15:101458802-101458824 TTAGCCTGGATTCAAGAAAGAGG - Intronic
1134475022 16:14566021-14566043 TGGTCCTGGCTTGGAGCAAGTGG - Intronic
1139005103 16:62560061-62560083 TTATCCTGAATTGGGGCAAAGGG + Intergenic
1141328604 16:83086498-83086520 TTATCAAGGATTGAGCCAAGCGG + Intronic
1143530843 17:7502500-7502522 GTATCCTGGAGGGAAGTAAGGGG - Exonic
1144281471 17:13731085-13731107 TTGTCCCAGATTGAGGCAAGAGG + Intergenic
1147700294 17:42389356-42389378 TTTTACTGAATTGAAGCCAGTGG + Intergenic
1149779000 17:59381520-59381542 ATACTCTGGATTGAAGCAGGAGG - Intronic
1150665036 17:67126423-67126445 GTATCCTGTATTGAACCATGTGG - Intronic
1152498793 17:80694557-80694579 TGATGCTGGATGGAAGGAAGGGG - Intronic
1153390682 18:4554694-4554716 ATATCCTAGAATTAAGCAAGTGG - Intergenic
1155049163 18:22131524-22131546 TTCTCCTGGATTCCAGGAAGTGG - Intergenic
1158012502 18:52745324-52745346 GTGGCCTGGATTGGAGCAAGGGG - Intronic
1158848831 18:61473391-61473413 TTATTATGGATTAAAGCATGTGG + Intronic
1165148235 19:33745724-33745746 TTGACCTGAATTGATGCAAGGGG + Intronic
1167471861 19:49680020-49680042 GTAAACTGGTTTGAAGCAAGAGG - Intronic
1168054278 19:53853060-53853082 TCATCCTGAATGGATGCAAGAGG - Intergenic
925833941 2:7924533-7924555 TTATGCTACTTTGAAGCAAGAGG - Intergenic
927084638 2:19662192-19662214 TTACCCTGGGGTGAAGCAGGGGG - Intergenic
929939379 2:46321044-46321066 TTATCGGGGATTGGAGCATGTGG - Intronic
931127737 2:59296499-59296521 TTACTCTGGAGTGAAGCCAGGGG - Intergenic
935373833 2:102375253-102375275 ATGTGCTGGATTGAAGAAAGTGG + Intronic
935428847 2:102950981-102951003 TTTTCCTAAATTGAAGCAAAGGG - Intergenic
936048435 2:109204260-109204282 TTATCTAGGAATGAAGCAACAGG - Intronic
939096618 2:137839865-137839887 TTATCCTGGATTACTGTAAGTGG - Intergenic
943822564 2:192345168-192345190 TTCTGCTTGATGGAAGCAAGAGG + Intergenic
944466130 2:200001730-200001752 TTCTTCTGGTTGGAAGCAAGAGG - Intronic
944878647 2:203988611-203988633 TGATCCTGGACTGAAGCCTGGGG + Intergenic
947623965 2:231607893-231607915 TTGTCCTGAGTTGAGGCAAGAGG - Intergenic
948134113 2:235623010-235623032 TTATTCTGGATTGAGAAAAGTGG + Intronic
1170427293 20:16247533-16247555 TTACCCTGAACTGAACCAAGGGG + Intergenic
1173245572 20:41335310-41335332 AGCTCCTGGATTGAAGGAAGTGG + Intergenic
1173259512 20:41421178-41421200 ATTTCCTGGATTCAAGGAAGGGG + Exonic
1179185667 21:39083535-39083557 TTGTCCTACATTGAACCAAGGGG - Intergenic
1183802498 22:40178840-40178862 TGATCCTGGATTCAACCAAAGGG + Intronic
1185121882 22:48976376-48976398 TTTTCCTGGGTTGAGGCACGTGG - Intergenic
949403025 3:3684838-3684860 TTGTCCTGAATTGAGGCCAGAGG - Intergenic
951356104 3:21668302-21668324 TTTTCCTGCTTTGAGGCAAGGGG - Intronic
951439091 3:22702120-22702142 TTTTCCTAGATTGAAACAAAAGG + Intergenic
952738197 3:36710835-36710857 CTGTCCTGAGTTGAAGCAAGGGG + Intergenic
955227172 3:57070186-57070208 TTCTCCAGGCATGAAGCAAGGGG + Intronic
956168368 3:66413425-66413447 TTTTCCTGGGTTGAGGCATGTGG - Intronic
957368751 3:79262567-79262589 TAAACTTGGATTGAAGCAATAGG + Intronic
957650690 3:82998733-82998755 TTCTCCTGGATTGACTCATGAGG + Intergenic
959308438 3:104698321-104698343 TTTTCCTGCAATGAAACAAGTGG - Intergenic
959606613 3:108248538-108248560 CTAGCCTGGATTGAGGGAAGAGG - Intergenic
961471073 3:127113169-127113191 TTTTACTGAATTTAAGCAAGTGG - Intergenic
963887745 3:150600541-150600563 TTATCATTAATTGCAGCAAGAGG - Intronic
968228709 3:196991862-196991884 TTATCTTGCCTTGAGGCAAGAGG - Intronic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
975199693 4:71572409-71572431 TCATCCTGGATTCAAGAAAGTGG - Intergenic
978687778 4:111468408-111468430 ATATCTTGAATTAAAGCAAGAGG + Intergenic
978993714 4:115122271-115122293 TTTTTCTGGTTTGAAGAAAGAGG + Intergenic
979684509 4:123496598-123496620 TTGTCCTGAGTTGAATCAAGAGG - Intergenic
980012805 4:127615578-127615600 TTGTTCTGAGTTGAAGCAAGAGG - Intergenic
980479421 4:133368258-133368280 TTATCCTGAATTGAATCAATGGG + Intergenic
981727094 4:147860130-147860152 TTATTTTCAATTGAAGCAAGAGG - Intronic
981901162 4:149865475-149865497 ATGTCCTGAATTGAGGCAAGGGG + Intergenic
982782294 4:159503982-159504004 ATATTCAGGATTGAAGTAAGGGG - Intergenic
983710536 4:170710172-170710194 AGATACTGGATTGAAGGAAGAGG - Intergenic
984554793 4:181200890-181200912 TTATCCTGGTTTGATTCATGTGG + Intergenic
986162746 5:5245662-5245684 TGTTTCTGGAATGAAGCAAGAGG - Intronic
986985345 5:13494370-13494392 AGATCCTGGACTGAAGGAAGTGG - Intergenic
989280268 5:39633129-39633151 TTCTACTGGCTGGAAGCAAGTGG - Intergenic
990311021 5:54538726-54538748 ATATCCTGAATTGAAGCGAATGG - Intronic
990567061 5:57040786-57040808 TTGTTCTGTATTGAGGCAAGAGG + Intergenic
993159869 5:84276258-84276280 TAAAACTGGATTGCAGCAAGAGG - Intronic
994314851 5:98321061-98321083 ATTTCCTGGATTGAATTAAGTGG - Intergenic
995614157 5:113942241-113942263 GTATCCTTGATTGATGCAATGGG + Intergenic
997124767 5:131214709-131214731 TTGTTCTGAATTGAGGCAAGGGG + Intergenic
998477485 5:142433876-142433898 TTTTTCTGGAAAGAAGCAAGGGG + Intergenic
1000597189 5:163229748-163229770 TTGCCCTGAATTGAGGCAAGGGG + Intergenic
1002481789 5:179506192-179506214 TCATCCTGCACTGAAGCATGGGG - Intergenic
1005215686 6:23525255-23525277 TGATTCTGCATTGAAGCAATGGG + Intergenic
1009571261 6:65388566-65388588 ATACCAAGGATTGAAGCAAGAGG + Intronic
1009865740 6:69395536-69395558 TTACCGTGGAATGAAGCATGAGG - Intergenic
1009922367 6:70078476-70078498 TTCTCCTGCCTTGAAGCAAGGGG + Intronic
1010321695 6:74518033-74518055 TTATCCTGGATTATCCCAAGTGG + Intergenic
1011599923 6:89050462-89050484 TTGTCCTGGGTAAAAGCAAGTGG + Intergenic
1014950266 6:127546101-127546123 TTATCCTGCATTGGATTAAGTGG + Intronic
1016275627 6:142349168-142349190 TTATGTTTGATTGAAACAAGAGG - Intronic
1016743084 6:147549040-147549062 TGATCCTGGAGTGAAGAAAATGG + Intronic
1016868252 6:148790774-148790796 TTGTCCCAGATTGACGCAAGGGG - Intronic
1017390054 6:153927871-153927893 TCATCCTGAATTGGAGCATGTGG - Intergenic
1020976030 7:15007718-15007740 TTTTCCTAGATTGAGTCAAGAGG + Intergenic
1021611503 7:22462158-22462180 TAATCCAGGAGTGAAGCTAGGGG - Intronic
1022300494 7:29098075-29098097 TTATTCTGGGCTGAAGCCAGGGG - Intronic
1022399018 7:30018115-30018137 TTATCTTGGATGGAAGAAAAAGG + Intronic
1023597792 7:41850754-41850776 ATATTCTGAATTGAGGCAAGAGG - Intergenic
1028154689 7:87416477-87416499 TTATCCTTTATTGAAACATGAGG - Intronic
1028745775 7:94324646-94324668 CCATCCTGGATTGGAGGAAGAGG + Intergenic
1029929489 7:104355804-104355826 TCATCCTGGATAGATGCCAGTGG - Intronic
1031580512 7:123468563-123468585 TTGTCCTGAATTTAGGCAAGGGG - Intronic
1031656981 7:124368320-124368342 GTATCCTCAAATGAAGCAAGGGG + Intergenic
1034408438 7:150922260-150922282 TGATCCTGGATTGCAGCTAGTGG + Intergenic
1038120442 8:24608407-24608429 TGATGGTGGATTGGAGCAAGGGG + Intergenic
1038372564 8:27008751-27008773 TTTTCCTGTATTAAAACAAGAGG - Intergenic
1039578033 8:38641191-38641213 TTGTCCTGCCTTGAGGCAAGGGG - Intergenic
1041844361 8:62310919-62310941 TAATCCTGGATTGAAACCTGAGG - Intronic
1042036321 8:64538379-64538401 TTTCCCTGGAATGAAGAAAGAGG + Intergenic
1043350391 8:79353435-79353457 TTGTCCTGCCCTGAAGCAAGAGG - Intergenic
1047844678 8:128793200-128793222 TAAGCCTGGAGTGAAGCAACTGG - Intergenic
1052052918 9:23868156-23868178 TTATCCAGGGTTGGAGCCAGAGG - Intergenic
1057433219 9:95014656-95014678 TACTACTGGATTGAAGGAAGTGG + Intronic
1186273182 X:7912042-7912064 TTATGCAGGACTGAAGCTAGTGG - Exonic
1186601411 X:11041666-11041688 TTGTCCTGCCTTGAGGCAAGGGG - Intergenic
1186965933 X:14786092-14786114 TTGTCCTGCCTTGAAGCAAGGGG + Intergenic
1187722443 X:22165430-22165452 TTGTCCTGAATTGAGGCAAGGGG + Intronic
1189566052 X:42242347-42242369 TTGTCCTAAATTGAAGCAGGGGG - Intergenic
1189716419 X:43871144-43871166 TTATCCTGGATTGAAGCAAGAGG + Intronic
1190216968 X:48486007-48486029 TTAACCTGGATAGAAGCCAGGGG + Exonic
1193297187 X:79846972-79846994 TTAGCCTGGATTTAAGGTAGAGG + Intergenic
1195482229 X:105358979-105359001 TTATCCCAAATTGAAACAAGGGG + Intronic
1196945828 X:120825034-120825056 TTATCTTTGATTGAAGGAGGTGG + Intergenic
1199198116 X:145056448-145056470 TTGTCCTGAATTGAAGCAAGGGG - Intergenic