ID: 1189717027

View in Genome Browser
Species Human (GRCh38)
Location X:43877513-43877535
Sequence CGTTATCTACATGCTGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189717027 Original CRISPR CGTTATCTACATGCTGTACA AGG (reversed) Intronic
1068245825 10:54365836-54365858 CTCTATCTACATGTTGAACACGG - Intronic
1077902203 11:6498459-6498481 CGCTATCTTCATGCAGTACTGGG + Exonic
1086080155 11:82895745-82895767 CTTTATCAACATGCCCTACAAGG + Intronic
1095699228 12:45174314-45174336 TTTTATCTACTTGCTGAACAAGG + Intergenic
1105605754 13:21925287-21925309 CTTCAACTACATGCTGTGCAGGG + Intergenic
1116095854 14:40366148-40366170 CATTCTTTACATGTTGTACATGG + Intergenic
1119363453 14:74071189-74071211 AGTTACCTTCATGCTGTCCATGG + Exonic
1121136733 14:91505915-91505937 GTTTATCTACAAGCTTTACATGG - Intronic
1122952206 14:105051200-105051222 CATTATCTACGTGCTGGCCACGG - Exonic
1129749746 15:78053504-78053526 GGTTATCTCCATGCTGCAAATGG + Intronic
1130775933 15:86982895-86982917 CCTCATCTTCATGCTGTTCAAGG + Intronic
1132695166 16:1198815-1198837 CGTTATCTGCATGGTGGGCAGGG - Intronic
1134789221 16:16973421-16973443 GCTTAACTACATGCTGGACACGG - Intergenic
1137343866 16:47636772-47636794 CATCATCAACATGCTGTCCATGG - Intronic
1142202086 16:88765972-88765994 CGCTATCTCCATTCTGAACAGGG + Intronic
1144485723 17:15662724-15662746 CATTATCTACATGAGATACAGGG + Intronic
1145959713 17:28880261-28880283 CTTAATCTACATGATGTGCATGG + Exonic
1150095213 17:62368060-62368082 CTTTATCATCATGCTCTACAAGG + Intergenic
1150965816 17:69967346-69967368 AGTTATCAAAATGCTGAACATGG + Intergenic
1157483343 18:48069939-48069961 CTTTATGTACATGCTGTCCATGG + Intronic
1163329949 19:16629622-16629644 CATTGTGTACATGGTGTACATGG + Intronic
930258063 2:49114256-49114278 CATTATCCAAATGCTGAACATGG + Intronic
932256687 2:70293898-70293920 CGTTATCTCAATTTTGTACAAGG - Intergenic
935555696 2:104507390-104507412 CATTACCTCCATGCTGTCCATGG - Intergenic
941131031 2:161650872-161650894 CGCCATCAACATGCTGTCCATGG - Intronic
944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG + Intronic
945160293 2:206883588-206883610 AGTTAGCTACATGCTATAGAGGG + Intergenic
945240447 2:207671756-207671778 CCTTCTCAACATGCTGTAAAAGG - Intergenic
1170920152 20:20670491-20670513 CGGAATCTACATGTTTTACATGG - Intronic
1172853003 20:37980078-37980100 CGTGATCTGCAGGCTGTAGAAGG - Intergenic
1184851210 22:47122310-47122332 TGTCATCTACAGGCAGTACAGGG - Intronic
949893679 3:8753147-8753169 CTGGATCTACATGCTGTTCACGG - Exonic
958472549 3:94539227-94539249 CATTCTCTACAAGCTCTACAAGG - Intergenic
964927301 3:161975040-161975062 TGTCATCAACATGCTGTCCATGG + Intergenic
969385958 4:6848249-6848271 CATTATTTATATGCTGTACAGGG + Intronic
978685431 4:111437136-111437158 CCTAATCCACATGCTGTTCAAGG + Intergenic
983835522 4:172379187-172379209 CTTTATTTAGATGCTGTAGATGG - Intronic
990764916 5:59171318-59171340 CATTATCTTGATCCTGTACAAGG + Intronic
995033066 5:107501127-107501149 CTTGATCTATATGCTGTAGAAGG - Intronic
996327493 5:122291927-122291949 CCTTCTGTACATGCTGTACAAGG - Intergenic
1016286198 6:142475928-142475950 CATTATCTTCATGCTTTACAGGG + Intergenic
1019054929 6:169216540-169216562 TGTTATCTATCTGCTGTATATGG - Exonic
1019440336 7:1042793-1042815 CGTTATCTCCATGGTATAAATGG - Intronic
1022402037 7:30047896-30047918 TTTTATCTACTTGCTGAACAAGG - Exonic
1037974988 8:23202647-23202669 CCTGATTTACAAGCTGTACATGG + Exonic
1040455248 8:47591644-47591666 CTTTATTTAGATGCTGTAGATGG - Intronic
1042350018 8:67767516-67767538 CACAATCTACATGCTATACAGGG - Intergenic
1045888020 8:107122912-107122934 CGTCATCAACCTGCTGTGCATGG - Intergenic
1052559710 9:30069657-30069679 TGATATCTACATTCTGTCCAGGG - Intergenic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1058083960 9:100729184-100729206 CATAATCTCCATGTTGTACATGG + Intergenic
1058499452 9:105595829-105595851 CGTTATCTATAAGCTATAGATGG - Intronic
1058778817 9:108312406-108312428 CGCTATTGACATGCTGGACAGGG + Intergenic
1059670613 9:116488078-116488100 CATCATGTACATCCTGTACATGG - Intronic
1186310193 X:8309492-8309514 TGTTCTCTACCTGCTGTGCAGGG + Intergenic
1189717027 X:43877513-43877535 CGTTATCTACATGCTGTACAAGG - Intronic
1196688786 X:118536330-118536352 CATTATTGACATGCTGTATAGGG + Intronic
1197526859 X:127575133-127575155 TGTTATCAACTTGCTGTCCATGG - Intergenic
1197601419 X:128535330-128535352 AGTTATCTACATGCTGTATCGGG + Intergenic
1198334429 X:135652892-135652914 TGTTATCTACATACTGTAGGTGG - Intergenic
1200019374 X:153188998-153189020 CCTCATCTACATACTGCACATGG - Intergenic