ID: 1189717539

View in Genome Browser
Species Human (GRCh38)
Location X:43881753-43881775
Sequence CAGGCCCTCCTGATTCTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189717539_1189717543 0 Left 1189717539 X:43881753-43881775 CCTCAAAGAATCAGGAGGGCCTG 0: 1
1: 0
2: 1
3: 12
4: 216
Right 1189717543 X:43881776-43881798 GAAAGTCTTTGGCAATCGATTGG 0: 1
1: 0
2: 0
3: 6
4: 83
1189717539_1189717544 5 Left 1189717539 X:43881753-43881775 CCTCAAAGAATCAGGAGGGCCTG 0: 1
1: 0
2: 1
3: 12
4: 216
Right 1189717544 X:43881781-43881803 TCTTTGGCAATCGATTGGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1189717539_1189717546 27 Left 1189717539 X:43881753-43881775 CCTCAAAGAATCAGGAGGGCCTG 0: 1
1: 0
2: 1
3: 12
4: 216
Right 1189717546 X:43881803-43881825 GCTCCAACCTCTTCTGTTCAAGG 0: 1
1: 0
2: 1
3: 16
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189717539 Original CRISPR CAGGCCCTCCTGATTCTTTG AGG (reversed) Intronic
900588896 1:3450298-3450320 CATGCCCAGCTGATCCTTTGGGG + Intergenic
900606867 1:3527628-3527650 CTGTCCCTCCAGCTTCTTTGGGG - Intronic
901737303 1:11320492-11320514 CAGAGCCTCCTGGGTCTTTGGGG - Intergenic
902786541 1:18735931-18735953 CAGGGCCTCCTGCTTGTTTATGG + Exonic
903738885 1:25546628-25546650 CAGGCCCTCCGGTTATTTTGTGG + Intronic
906104693 1:43284813-43284835 CACGCCCTCCTCAGTTTTTGGGG + Intronic
906458897 1:46022424-46022446 CAGGTCTTCCTGTGTCTTTGGGG + Intronic
906742809 1:48198928-48198950 CAGGTTCTGCTGATTATTTGAGG + Intergenic
907595799 1:55718773-55718795 CAAGTCCTACTGAGTCTTTGAGG - Intergenic
908746564 1:67382237-67382259 CAGATCCTCCTGATTGTATGGGG + Intronic
911013495 1:93306830-93306852 CATGCCCTCCTGCCTATTTGAGG + Intergenic
914195552 1:145446393-145446415 CAGGGTCCCCTGATTCTGTGCGG - Intergenic
915269356 1:154742687-154742709 CAGGGCCTGCTGCTTCTTCGGGG + Intronic
915393625 1:155565138-155565160 CATGCCCACCTGATTTTTTTTGG - Intergenic
916642296 1:166743464-166743486 CAAGCCCTCCACATCCTTTGGGG + Intergenic
917980830 1:180267938-180267960 CAGGGCTTCCTGTCTCTTTGAGG + Intronic
918282680 1:183022743-183022765 CAGGCCCTTCTGATTCTCCAGGG + Intergenic
920551928 1:206869295-206869317 CAGGTCCTCTTGCTCCTTTGAGG + Intergenic
920670747 1:208002238-208002260 CAGGCCCTCCAGATGCATTTGGG - Intergenic
922059594 1:222075316-222075338 CAGTCCATCCTCATTGTTTGTGG - Intergenic
922523515 1:226279002-226279024 CATGCCCTGCTAATTTTTTGTGG - Intronic
923215392 1:231844048-231844070 CAGTCTCTCATGCTTCTTTGTGG - Intronic
923271160 1:232356275-232356297 CAGGCCATGCTGATTGTTGGGGG + Intergenic
923920092 1:238554225-238554247 GCGGCCCTCCAGATGCTTTGGGG - Intergenic
924002261 1:239567588-239567610 CAGGTACTCCTCATTCTCTGGGG + Intronic
924642479 1:245847537-245847559 CAGGCCCACCTGATTTCTTTTGG + Intronic
1065862749 10:29885600-29885622 CAGGGCCTCTGGATTCTTTAGGG + Intergenic
1067787124 10:49258569-49258591 CAGGCCCTCCTCTTTCTTCCTGG - Intergenic
1069742606 10:70695058-70695080 CAAGCCATCCTATTTCTTTGTGG + Intronic
1071689862 10:87805677-87805699 CAACCCCTCCTGATTCTTCTGGG + Intronic
1073922792 10:108478899-108478921 CATGACATCCTGATTCTTTTGGG - Intergenic
1074102526 10:110364841-110364863 CAGGCCCTTCTGACTCACTGAGG - Intergenic
1074240229 10:111631551-111631573 CAGCCCTTCCTGAATCCTTGAGG + Intergenic
1074308381 10:112299803-112299825 CAGCACTTCCTGATTCTTTGGGG - Intronic
1076509468 10:131002077-131002099 CAGTCACTCCTGATGCTCTGGGG + Intergenic
1077037844 11:503863-503885 AAGGCCCTTCTGAATCTCTGTGG + Intronic
1080259855 11:30336604-30336626 CAGGGTCTCCTGATTTTTAGTGG + Exonic
1080654210 11:34245850-34245872 CAGTGGCTCCTGATACTTTGGGG - Intronic
1081823146 11:46020366-46020388 CAGGCGCTCCTGGTTCTTGGTGG - Intronic
1084007569 11:66331443-66331465 CAGGCCCTCCAGCATCTCTGGGG - Intronic
1085258064 11:75188173-75188195 TAGGCCATCCTGCTTCTTCGTGG - Exonic
1085328635 11:75628242-75628264 CAGTCCCTCCAGCTTCTTTCTGG - Intronic
1087819559 11:102696512-102696534 CATGCCCTCTTAATTCATTGTGG - Intronic
1089387380 11:118077228-118077250 GAGGCCCTCCTGCTGCCTTGGGG + Exonic
1090024078 11:123152870-123152892 CAGGCCCTCCTGAGTATGTTTGG - Intronic
1090258507 11:125302596-125302618 CAGGCCCTCCAGAGTATTGGGGG + Intronic
1090674917 11:128982998-128983020 TAGGCCCATCTGAATCTTTGTGG - Intronic
1091488918 12:916264-916286 CAGGGTCTTCTGATTCTCTGCGG - Intronic
1091744488 12:2982485-2982507 CAGGCCCTCCTGGGTCACTGTGG + Intronic
1092145564 12:6212320-6212342 CTGCCCCTTCTGATTCTTAGTGG - Intronic
1095096954 12:38154071-38154093 GAGGCCTTCTTGCTTCTTTGGGG - Intergenic
1095386362 12:41655118-41655140 CAGGACCTCCTTATCCTTGGGGG + Intergenic
1095951571 12:47784522-47784544 CAGGCTCTCCTGATGCTCTCAGG - Intronic
1103782019 12:123405139-123405161 CAGGAACTCCTGATTCTGTTTGG + Intronic
1103947686 12:124535592-124535614 CAGGTCTCCCTGAGTCTTTGAGG - Intronic
1105704251 13:22959868-22959890 CTGGCCCTCCTGATTCATGGAGG - Intergenic
1105857202 13:24384920-24384942 CTGGCCCTCCTGATTCATGGAGG - Intergenic
1106370909 13:29131570-29131592 CAGGCTGTCCTGTTTCCTTGTGG - Intronic
1108288163 13:48929234-48929256 CAGGCCCTGCTGATACACTGTGG - Intergenic
1109226170 13:59698791-59698813 CATGCCATCCTAATTCTTTTAGG - Intronic
1113046683 13:106163660-106163682 CAGGCCATCCTGTTCCTTTCTGG - Intergenic
1113762423 13:112858967-112858989 CAGGCCCTCCTCATCCTCAGGGG - Intronic
1114473253 14:22978031-22978053 CTGGCCCTCCAGCTTCTTGGTGG - Intronic
1115231286 14:31163444-31163466 CACGCCCAGCTAATTCTTTGGGG - Intronic
1120073952 14:80134748-80134770 CAGGCCCTGGTTATTCTTTAGGG - Intergenic
1122205546 14:100146264-100146286 CATGCACTCCTGGCTCTTTGTGG - Exonic
1124193302 15:27598865-27598887 CAGGCCTGCCTGATTGTTTCGGG - Intergenic
1126666596 15:51081125-51081147 CAAGCCCTCCTGAGTGTTAGAGG - Intronic
1128744561 15:70104264-70104286 CATGCCCACCTGAGACTTTGTGG + Intergenic
1128781662 15:70362527-70362549 CAGGCCCTCCTGGATCAATGTGG - Intergenic
1129518401 15:76170825-76170847 CTGACCCTCCTGAGTCTTTAGGG - Intronic
1131952461 15:97695424-97695446 CAGTGCCTGCTGATTCCTTGAGG + Intergenic
1132892083 16:2209502-2209524 CAGGCCCTCGGGATGGTTTGAGG - Intronic
1132896394 16:2231251-2231273 CAGGCCCTCCTGCCGCTTCGCGG + Intronic
1133783766 16:8959447-8959469 CCAGCTCTCCTGATTCTTTCAGG - Intronic
1134273538 16:12755833-12755855 CAGCAACTTCTGATTCTTTGAGG - Intronic
1135129862 16:19844422-19844444 AAAGCCCTCCTGATGCTGTGTGG - Intronic
1138199284 16:55077179-55077201 CAAGCCCATCTGCTTCTTTGGGG - Intergenic
1139459676 16:67111563-67111585 AAGGCCCTGCTGATGCTTAGTGG + Intronic
1139522741 16:67494112-67494134 CAGGCCCACATAATTCTTTCTGG + Intergenic
1140966612 16:79972517-79972539 CAGGCCATCCTGATGCTTTGGGG - Intergenic
1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG + Intergenic
1142987351 17:3704219-3704241 CAGGCCTTCCTGCTCCTTTGAGG - Intergenic
1143866858 17:9929905-9929927 CAGGCCGGCCTGAGTCTGTGAGG - Intronic
1143902304 17:10183503-10183525 CAGGCTCTCCTGATCCTCAGAGG + Intronic
1144936949 17:18907237-18907259 CAGCCACTCCTGATTCCTGGGGG - Intronic
1149729596 17:58931977-58931999 CCAGCCCTCCCAATTCTTTGGGG - Intronic
1150221046 17:63496134-63496156 CAGGCCCTCCTGAGTTGTGGAGG + Intronic
1152479177 17:80538527-80538549 ACGGCCCTACGGATTCTTTGTGG - Intergenic
1152719256 17:81914871-81914893 CAGGCCCTCTTGACTCCTGGTGG - Intronic
1154093737 18:11390143-11390165 CAGGCTCTCCTAATTATTTATGG - Intergenic
1157424903 18:47576657-47576679 CAGGGGCTCCTGAATCTTTCAGG - Intergenic
1157494412 18:48144999-48145021 GAGGCATTCCTGGTTCTTTGGGG + Intronic
1161387564 19:4004396-4004418 CCGGCCCTGCTGATTCTGCGGGG - Intergenic
1161535239 19:4815151-4815173 CAGCCCTTCCTTTTTCTTTGGGG - Intergenic
1162018588 19:7858435-7858457 CTGGCCCTCCTGTTCCTTTCTGG + Intronic
1162713055 19:12610575-12610597 CAGACCCTCCTGTTCCTGTGCGG + Exonic
1163482687 19:17567371-17567393 CAGCCCATGCTGATGCTTTGTGG + Intronic
1165036760 19:33039293-33039315 CAGGCCCTCCATAGCCTTTGGGG - Intronic
1166314640 19:41982199-41982221 CAGGCCCTCAGGATTCTCTGGGG - Intronic
1168223049 19:54974954-54974976 CAGGCCCGGCTAATTTTTTGTGG + Intronic
925507338 2:4583268-4583290 CAGGCACTGCTGGTTCTTTTAGG - Intergenic
925565158 2:5244545-5244567 CAGGACCTCCTCATGATTTGGGG - Intergenic
925712361 2:6753675-6753697 CAGGGCCTCATGGATCTTTGTGG - Intergenic
926173595 2:10569695-10569717 AAGGGCCTCCTGGTTCTGTGGGG - Intergenic
926311114 2:11676982-11677004 CCGGCTCTCCTGATGCTCTGCGG + Intergenic
926322450 2:11758736-11758758 AAGCACCTTCTGATTCTTTGCGG + Intronic
927272591 2:21229037-21229059 CTGGCCTTCCTGATTCTTGTAGG + Intergenic
929168293 2:38905629-38905651 CCTGCCTTCCTGACTCTTTGAGG + Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934918019 2:98316673-98316695 CAGGCCCTCCTCAAACATTGGGG - Intergenic
935710640 2:105895104-105895126 CAGTCCCTCCAGACTCTTTCGGG + Intergenic
936065541 2:109329375-109329397 CAGGTCCACTTGATTCTTTGGGG - Intronic
937386687 2:121440533-121440555 CATGCCCTGCTAATTTTTTGTGG - Intronic
937487987 2:122335680-122335702 CAGGCTCTCCAGATGCTGTGTGG - Intergenic
938947421 2:136225829-136225851 CAGACCTGACTGATTCTTTGTGG + Intergenic
942777537 2:179601763-179601785 CTGGCTCTCTTGATTCTTTAAGG - Intronic
943778010 2:191788506-191788528 CTGGCCCTGCTGATTTCTTGAGG - Intergenic
944830564 2:203529900-203529922 AAGACCCTTCTGCTTCTTTGTGG + Intronic
946226229 2:218265479-218265501 CAGGCCCTCATGAGTCTTCATGG - Intronic
946335778 2:219035611-219035633 CACTCTCTCCTGCTTCTTTGGGG + Exonic
948318625 2:237051065-237051087 CAAATCCTCCTGAGTCTTTGAGG - Intergenic
948625244 2:239264560-239264582 GAGGCCCTCCTGATCCTAAGTGG + Intronic
1169448954 20:5695077-5695099 CAGGCCCCCTTAAATCTTTGTGG - Intergenic
1173893802 20:46534354-46534376 CAGGCACTCCTGAGCCTGTGAGG - Intergenic
1174819971 20:53718191-53718213 CAGGCCCTCATGCCTCTGTGGGG - Intergenic
1175164046 20:57030459-57030481 CAGCCCCTCATTATTCTTGGGGG + Intergenic
1175467044 20:59196481-59196503 CAGGGCCTCCTGTTTGTTGGGGG - Intronic
1175636266 20:60586881-60586903 CAGCCCCTCCTGATTCTGGAGGG + Intergenic
1175703788 20:61160585-61160607 CAGTCCCTCCTGATTCATCTTGG + Intergenic
1176087979 20:63306715-63306737 CAGGCCCTCCCAGTTCTATGGGG - Intronic
1176667044 21:9697278-9697300 CAGCCCCTCCTGCTTATATGTGG + Intergenic
1179001331 21:37462330-37462352 CAGACCATCTTGATCCTTTGAGG + Intronic
1179253882 21:39698487-39698509 CAGGCACTCCTCATTCCTTATGG - Intergenic
1179348523 21:40584600-40584622 GAGTCCCTGCTGCTTCTTTGAGG - Intronic
1182831852 22:33310562-33310584 CCGGCTCTCCTAATTCGTTGTGG + Intronic
1184413596 22:44339500-44339522 CCGGCCCTGCTGATACCTTGAGG + Intergenic
1184751857 22:46490900-46490922 CTGGACCTCCTGATCCTCTGAGG - Intronic
1185311501 22:50158219-50158241 CAGGCACGCCTGGTTCTGTGAGG + Intronic
950133593 3:10564641-10564663 CAGAGCCTCCTAATTCTTAGAGG + Intronic
950438656 3:12994734-12994756 CACACCCTCCTGACTGTTTGGGG + Intronic
954199597 3:49016420-49016442 CAGGCTCACCTGACTCTGTGGGG + Exonic
955198119 3:56824512-56824534 CAGGCTCTACTACTTCTTTGAGG + Intronic
957534901 3:81489024-81489046 CTGGCACTGCTGATTCTTTCAGG + Intergenic
957949918 3:87111319-87111341 CAGCACCCACTGATTCTTTGTGG + Intergenic
960863969 3:122181785-122181807 CAGGCAGCCCTGATTCATTGTGG + Intergenic
961075571 3:123978798-123978820 CATGCCCTCCTTTTTCATTGTGG + Intronic
961308116 3:125973710-125973732 CATGCCCTCCTTTTTCATTGTGG - Intronic
964764320 3:160164168-160164190 CTGGCCCTCTTGCTTCTTTTAGG - Intergenic
967104167 3:186242126-186242148 CAGCCCCTCATGATTCTTTTGGG - Intronic
972926675 4:44016900-44016922 CAGTCCCTCCTTCTTCTGTGTGG - Intergenic
973839208 4:54843773-54843795 CTAGCCCTACTGATTGTTTGTGG + Intergenic
975548798 4:75588896-75588918 CAAGTCCTCATCATTCTTTGAGG - Intronic
976475574 4:85478766-85478788 AAGTCCCTCTTGATTCTTGGTGG + Intronic
978419110 4:108511293-108511315 CATGCCCACCTGATTCCTTCTGG - Intergenic
981101605 4:140835047-140835069 CAGCATCTCCTCATTCTTTGGGG - Intergenic
982654375 4:158129263-158129285 CAGGCACTCCTAATTCTAAGAGG + Intronic
983702422 4:170614482-170614504 CAGGGCTTCCTGAAGCTTTGTGG - Intergenic
984864650 4:184271331-184271353 CAGGCCATCCTGCTGCTTTGTGG - Intergenic
984918867 4:184746723-184746745 CAGACTCTCCTGACCCTTTGGGG - Intergenic
985407969 4:189655059-189655081 CAGCCCCTCCTGCTTATGTGTGG - Intergenic
985648126 5:1094814-1094836 GAGCCCCTCCTGAGTCTTTCAGG + Intronic
986509825 5:8492333-8492355 CAGGACCTCTTGAGTCTCTGCGG - Intergenic
988346292 5:30041899-30041921 CAGGCACTTCTGAATCTGTGGGG - Intergenic
989188016 5:38643455-38643477 CTGGCCCTCCTGTTCCTGTGTGG - Intergenic
991581611 5:68161434-68161456 AAGGCCCATCTGGTTCTTTGTGG - Intergenic
992256589 5:74927419-74927441 TGGGCCCTCCTGACTCTTTCAGG - Intergenic
992361755 5:76045795-76045817 CAAGGCCTCCTTATTCTGTGGGG + Intergenic
993064075 5:83077155-83077177 CAGTCCGTCCTGATTCTCTCTGG + Intronic
993872976 5:93273631-93273653 CTGTCCCTCCTGATACTGTGTGG - Intergenic
995450206 5:112291705-112291727 CAAGTCCTCTTGAGTCTTTGTGG - Intronic
996443855 5:123521908-123521930 CAGGCCCTACTGATTATTTATGG - Intronic
996760696 5:126983376-126983398 CAGGCTTTCCTGAGTCTTTGAGG + Intronic
998054881 5:139065872-139065894 CAGGCCCTACTGACTACTTGTGG + Intronic
1000300526 5:159952151-159952173 GAGGCCCTTCTTATTCTTGGGGG + Intronic
1001784401 5:174399592-174399614 CCAGCCCTCCTGATGCTTGGGGG - Intergenic
1002480107 5:179495294-179495316 CAGGCCTGCCTGATACTTTCTGG - Intergenic
1010010059 6:71038842-71038864 CACTTCCTCCTGATTCCTTGAGG - Intergenic
1010824378 6:80454745-80454767 GAGGGGCTCCTGATTCTGTGTGG - Intergenic
1015037740 6:128677780-128677802 CTGGCCCTTGTGATTTTTTGTGG + Intergenic
1017787728 6:157770152-157770174 CAAGGCCTCCAGATTTTTTGTGG + Intronic
1017941370 6:159056057-159056079 GATGCCCTCCTGATGCTGTGGGG - Intergenic
1017996035 6:159532378-159532400 CAGGCCTCTCTGATTCTTGGAGG - Intergenic
1019606729 7:1913774-1913796 CAGGCCGTCCGGATTCCGTGGGG + Intronic
1022654539 7:32306725-32306747 CAGGCCCTACAGAATCTTGGGGG + Intergenic
1023458707 7:40369745-40369767 CAGGCCCACTTTATTCTCTGTGG - Intronic
1024462447 7:49672379-49672401 CAGCCCCTCCCGATTCTCTTGGG - Intergenic
1030165727 7:106553223-106553245 AAGGCCATCCTTAATCTTTGGGG + Intergenic
1030373192 7:108723981-108724003 TAGGCACGACTGATTCTTTGGGG + Intergenic
1034052283 7:147996018-147996040 CAGGCCCTTCTGAGGCTGTGAGG + Intronic
1034484610 7:151351116-151351138 CAGGCCATGGTGTTTCTTTGAGG + Intronic
1036449445 8:8853013-8853035 CAGGACCTCCTGCTTCCTTTGGG - Intronic
1041056121 8:53988157-53988179 CAAGCACTTCTGATTCTGTGCGG - Exonic
1043035232 8:75189158-75189180 AAGTCCTTCCTGATGCTTTGGGG + Intergenic
1046005075 8:108469778-108469800 TAGGCCCTTATGATTCCTTGGGG - Intronic
1046724081 8:117655603-117655625 CTGGAGCTGCTGATTCTTTGGGG - Intergenic
1047285258 8:123482328-123482350 CAGGCCCTCATGATTAGATGTGG + Intergenic
1047915232 8:129575781-129575803 CAGGCCCAAATGCTTCTTTGAGG - Intergenic
1049628931 8:143641107-143641129 CCAGCCCTCATGAATCTTTGAGG - Intronic
1049965599 9:776319-776341 CAGGTCCTCCTGTTTCCCTGGGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055357075 9:75448593-75448615 CAGGCCCCACTGAATCTTGGAGG - Intergenic
1056592204 9:87972845-87972867 CAGGCCATTTTGATTTTTTGAGG - Intronic
1058270734 9:102968344-102968366 CAGGCACTTCTGAGTCTGTGGGG + Intergenic
1058777844 9:108302741-108302763 AAGACCCTCCTGAGTCTTTTGGG - Intergenic
1059387012 9:113972534-113972556 CACGCCCTCCTGCTTCTTGGTGG + Intronic
1060538317 9:124410808-124410830 CTGGCCTTCCTGATAATTTGCGG - Intronic
1060920840 9:127419234-127419256 CAGACCCTCCTTGGTCTTTGGGG + Intergenic
1061233890 9:129331167-129331189 CAGGCCAGCCTGATTGATTGTGG + Intergenic
1061403712 9:130382430-130382452 CAGTCCTGCATGATTCTTTGAGG - Intronic
1061409339 9:130410414-130410436 GAGGCCCTTCTGATGCTCTGCGG + Intronic
1062243663 9:135552588-135552610 CAGGACCTCCTGATTGTCTTGGG + Intergenic
1062318346 9:135978781-135978803 CAGGCCCTCCTGGGTCTGAGAGG - Intergenic
1062422276 9:136488561-136488583 CAGGCCTTCCTGCTCCTCTGAGG + Intergenic
1062699113 9:137889957-137889979 CAGGGTCCCCTGATTCTGTGCGG + Intronic
1203659052 Un_KI270753v1:24484-24506 CAGCCCCTCCTGCTTATATGTGG - Intergenic
1189019121 X:37316403-37316425 CAGGCCCACCTGATGGCTTGTGG + Intergenic
1189682153 X:43527720-43527742 CAGGCACTCCTGATTCTCACTGG + Intergenic
1189717539 X:43881753-43881775 CAGGCCCTCCTGATTCTTTGAGG - Intronic
1189760194 X:44314406-44314428 CAGGCCTTCCTCATTCTTCCAGG - Intronic
1189911869 X:45818120-45818142 CATGCCCACCTGATTTTTTTAGG - Intergenic
1190432382 X:50390729-50390751 CAAGACCTACTGAATCTTTGTGG + Intronic
1190950817 X:55141048-55141070 CATTCCCTCCTGCTGCTTTGTGG + Intronic
1196612008 X:117726290-117726312 CAGGCCTTAATGATTGTTTGGGG - Intergenic