ID: 1189717630

View in Genome Browser
Species Human (GRCh38)
Location X:43882193-43882215
Sequence CTCGGACAGGTGGCTGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189717630_1189717639 -3 Left 1189717630 X:43882193-43882215 CCCCAGGCAGCCACCTGTCCGAG 0: 1
1: 0
2: 0
3: 24
4: 200
Right 1189717639 X:43882213-43882235 GAGCGCGTGAAGAGGAAGGAGGG 0: 1
1: 0
2: 5
3: 33
4: 406
1189717630_1189717636 -7 Left 1189717630 X:43882193-43882215 CCCCAGGCAGCCACCTGTCCGAG 0: 1
1: 0
2: 0
3: 24
4: 200
Right 1189717636 X:43882209-43882231 GTCCGAGCGCGTGAAGAGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 50
1189717630_1189717638 -4 Left 1189717630 X:43882193-43882215 CCCCAGGCAGCCACCTGTCCGAG 0: 1
1: 0
2: 0
3: 24
4: 200
Right 1189717638 X:43882212-43882234 CGAGCGCGTGAAGAGGAAGGAGG 0: 1
1: 0
2: 1
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189717630 Original CRISPR CTCGGACAGGTGGCTGCCTG GGG (reversed) Intronic