ID: 1189719905

View in Genome Browser
Species Human (GRCh38)
Location X:43905420-43905442
Sequence TGCTACCAACTGGTGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189719905_1189719915 24 Left 1189719905 X:43905420-43905442 CCAAGTTCCACCAGTTGGTAGCA No data
Right 1189719915 X:43905467-43905489 AGCCTAGAGCCTGCAGCCTGGGG No data
1189719905_1189719914 23 Left 1189719905 X:43905420-43905442 CCAAGTTCCACCAGTTGGTAGCA No data
Right 1189719914 X:43905466-43905488 AAGCCTAGAGCCTGCAGCCTGGG No data
1189719905_1189719913 22 Left 1189719905 X:43905420-43905442 CCAAGTTCCACCAGTTGGTAGCA No data
Right 1189719913 X:43905465-43905487 GAAGCCTAGAGCCTGCAGCCTGG No data
1189719905_1189719912 -4 Left 1189719905 X:43905420-43905442 CCAAGTTCCACCAGTTGGTAGCA No data
Right 1189719912 X:43905439-43905461 AGCAGGTGGAAGGGAAGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189719905 Original CRISPR TGCTACCAACTGGTGGAACT TGG (reversed) Intergenic
No off target data available for this crispr