ID: 1189723291

View in Genome Browser
Species Human (GRCh38)
Location X:43942749-43942771
Sequence ATGTTCTGGTAGTAGTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189723291_1189723293 -10 Left 1189723291 X:43942749-43942771 CCATCAGACTACTACCAGAACAT No data
Right 1189723293 X:43942762-43942784 ACCAGAACATACTTCAGAATGGG No data
1189723291_1189723295 11 Left 1189723291 X:43942749-43942771 CCATCAGACTACTACCAGAACAT No data
Right 1189723295 X:43942783-43942805 GGCTAACTCACATGTTAAAGAGG No data
1189723291_1189723296 28 Left 1189723291 X:43942749-43942771 CCATCAGACTACTACCAGAACAT No data
Right 1189723296 X:43942800-43942822 AAGAGGAATCGTTAAAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189723291 Original CRISPR ATGTTCTGGTAGTAGTCTGA TGG (reversed) Intergenic
No off target data available for this crispr