ID: 1189726740

View in Genome Browser
Species Human (GRCh38)
Location X:43975088-43975110
Sequence GGGAGAAATGAGAAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189726740_1189726743 -7 Left 1189726740 X:43975088-43975110 CCGTCCACCTTCTCATTTCTCCC No data
Right 1189726743 X:43975104-43975126 TTCTCCCAAGAAATAATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189726740 Original CRISPR GGGAGAAATGAGAAGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr