ID: 1189739022

View in Genome Browser
Species Human (GRCh38)
Location X:44099896-44099918
Sequence CATTATGACCAGAATGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189739017_1189739022 10 Left 1189739017 X:44099863-44099885 CCAATCAACCCAGTTATAGCACA No data
Right 1189739022 X:44099896-44099918 CATTATGACCAGAATGTGGCAGG No data
1189739020_1189739022 1 Left 1189739020 X:44099872-44099894 CCAGTTATAGCACAGCAAGGTAA No data
Right 1189739022 X:44099896-44099918 CATTATGACCAGAATGTGGCAGG No data
1189739019_1189739022 2 Left 1189739019 X:44099871-44099893 CCCAGTTATAGCACAGCAAGGTA No data
Right 1189739022 X:44099896-44099918 CATTATGACCAGAATGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189739022 Original CRISPR CATTATGACCAGAATGTGGC AGG Intergenic
No off target data available for this crispr