ID: 1189740481

View in Genome Browser
Species Human (GRCh38)
Location X:44112643-44112665
Sequence TTATTTCAGAGAAGAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189740481_1189740485 -7 Left 1189740481 X:44112643-44112665 CCTTGGCCTCTTCTCTGAAATAA No data
Right 1189740485 X:44112659-44112681 GAAATAAGGAAATAGGACCTTGG No data
1189740481_1189740487 -3 Left 1189740481 X:44112643-44112665 CCTTGGCCTCTTCTCTGAAATAA No data
Right 1189740487 X:44112663-44112685 TAAGGAAATAGGACCTTGGGTGG No data
1189740481_1189740486 -6 Left 1189740481 X:44112643-44112665 CCTTGGCCTCTTCTCTGAAATAA No data
Right 1189740486 X:44112660-44112682 AAATAAGGAAATAGGACCTTGGG No data
1189740481_1189740489 26 Left 1189740481 X:44112643-44112665 CCTTGGCCTCTTCTCTGAAATAA No data
Right 1189740489 X:44112692-44112714 CTGAGCTCCCTTTCATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189740481 Original CRISPR TTATTTCAGAGAAGAGGCCA AGG (reversed) Intergenic
No off target data available for this crispr