ID: 1189740483

View in Genome Browser
Species Human (GRCh38)
Location X:44112649-44112671
Sequence ATTTCCTTATTTCAGAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189740483_1189740487 -9 Left 1189740483 X:44112649-44112671 CCTCTTCTCTGAAATAAGGAAAT No data
Right 1189740487 X:44112663-44112685 TAAGGAAATAGGACCTTGGGTGG No data
1189740483_1189740489 20 Left 1189740483 X:44112649-44112671 CCTCTTCTCTGAAATAAGGAAAT No data
Right 1189740489 X:44112692-44112714 CTGAGCTCCCTTTCATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189740483 Original CRISPR ATTTCCTTATTTCAGAGAAG AGG (reversed) Intergenic
No off target data available for this crispr