ID: 1189740488

View in Genome Browser
Species Human (GRCh38)
Location X:44112676-44112698
Sequence AGCTCAGACACAACCACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189740488_1189740494 23 Left 1189740488 X:44112676-44112698 CCTTGGGTGGTTGTGTCTGAGCT No data
Right 1189740494 X:44112722-44112744 CATTCAAGACACACTCATCAAGG No data
1189740488_1189740489 -7 Left 1189740488 X:44112676-44112698 CCTTGGGTGGTTGTGTCTGAGCT No data
Right 1189740489 X:44112692-44112714 CTGAGCTCCCTTTCATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189740488 Original CRISPR AGCTCAGACACAACCACCCA AGG (reversed) Intergenic
No off target data available for this crispr