ID: 1189744049

View in Genome Browser
Species Human (GRCh38)
Location X:44151573-44151595
Sequence AAAGCTGCGTGAAGACATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189744049_1189744050 7 Left 1189744049 X:44151573-44151595 CCAATATGTCTTCACGCAGCTTT 0: 1
1: 0
2: 2
3: 10
4: 122
Right 1189744050 X:44151603-44151625 AGTCACCAATCAATGCATTTAGG 0: 1
1: 0
2: 0
3: 38
4: 304
1189744049_1189744051 8 Left 1189744049 X:44151573-44151595 CCAATATGTCTTCACGCAGCTTT 0: 1
1: 0
2: 2
3: 10
4: 122
Right 1189744051 X:44151604-44151626 GTCACCAATCAATGCATTTAGGG 0: 1
1: 0
2: 1
3: 17
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189744049 Original CRISPR AAAGCTGCGTGAAGACATAT TGG (reversed) Intronic
909430574 1:75583133-75583155 GAAGCTGTGAGAAGACATAGGGG + Intronic
909857784 1:80561113-80561135 AAAGGTGGGGGAAGGCATATAGG + Intergenic
916341641 1:163743619-163743641 AAATCTGCTGGCAGACATATTGG + Intergenic
917124547 1:171675190-171675212 AAAGTTGCCTGGAGACATACTGG - Intergenic
918706885 1:187674509-187674531 AACGTTGTGTGAAGACATAGTGG + Intergenic
919056199 1:192572269-192572291 AAAGCTTTGTGAGTACATATGGG + Intergenic
919890967 1:201974285-201974307 AAGGCAGCATGAAGACATTTTGG - Intergenic
920809691 1:209271101-209271123 AAAAATGTTTGAAGACATATTGG - Intergenic
920812389 1:209298819-209298841 AAAGCTTCTTGAAGGCAGATAGG + Intergenic
922990564 1:229907101-229907123 AAAGCTCCGTGAATATACATAGG + Intergenic
923621132 1:235580491-235580513 AAAGATGCGTGAGCACACATGGG - Intronic
1069495317 10:68898415-68898437 AAAACTGATTTAAGACATATTGG - Intergenic
1073282258 10:102363219-102363241 GAAGATACGTGAAGACTTATAGG - Intronic
1076349226 10:129803630-129803652 CAAGCTGGGTCAAGGCATATGGG - Intergenic
1076775625 10:132696508-132696530 GAAGCTGCGAGAAGACACAGAGG + Intronic
1078896214 11:15599564-15599586 AAACCTGAGTGCAGACATATGGG - Intergenic
1079142193 11:17818982-17819004 ACAGCTGCCTGAAGAAATCTGGG - Intronic
1080058321 11:27930753-27930775 AATTCTGCGTGTGGACATATTGG - Intergenic
1080739641 11:35051641-35051663 AAAACAGGGTGAAGACAAATTGG - Intergenic
1081119718 11:39251497-39251519 AAAGCTGAGTGAAGATCTATAGG - Intergenic
1087785367 11:102347659-102347681 AAAACTGCGAGAAAACATCTTGG - Exonic
1088997713 11:115016634-115016656 AAAACTGTGTCAAGACTTATGGG - Intergenic
1090232938 11:125122330-125122352 GAAGCTGCCTGAACACATACTGG - Intergenic
1090279428 11:125443318-125443340 AAAGCTGAGGGAAGACAATTGGG + Intergenic
1090316582 11:125796050-125796072 AAATCTGCATCCAGACATATTGG + Intergenic
1096423713 12:51482924-51482946 AAAGCTGAGGGAAGACAGTTTGG - Intronic
1096936132 12:55278992-55279014 AATGCTGCCTGAAGATAAATTGG - Intergenic
1099914603 12:88876671-88876693 TAAGTTGTGTGAGGACATATAGG - Intergenic
1101168955 12:102068157-102068179 AAAGCTTCGGGAAGAAATGTTGG - Intergenic
1107900893 13:45012435-45012457 AAATCTGAGTGATGACATATTGG + Intronic
1113222314 13:108119389-108119411 AAAGCTGGGTCAGGACATGTGGG - Intergenic
1115312997 14:31997732-31997754 AATTCTGCGTGAAAACATAAAGG + Intergenic
1116326956 14:43541675-43541697 AAAACTGCTTAAAGACATATGGG - Intergenic
1117843729 14:59888837-59888859 ACATCTGCTTGAAGACATAAAGG + Intergenic
1118014126 14:61640955-61640977 AAAGCTGTGTGAAGAGGCATTGG + Intronic
1118965625 14:70581465-70581487 AAAGCTGTGTGAAGAGACAAAGG - Intronic
1123045514 14:105511645-105511667 GAATCTGTGTGAAGACATATAGG - Intergenic
1123801139 15:23822374-23822396 AAAGGTGCATGAACACACATTGG - Intergenic
1125301173 15:38254068-38254090 ACAGCTGCGTGGAGAAATAATGG + Intronic
1125323712 15:38515063-38515085 ACAGCTGCGTGAAAACAGAAGGG + Intronic
1126472717 15:49031376-49031398 AAATCTTAGAGAAGACATATGGG - Intronic
1126887549 15:53166825-53166847 ACAGATGCGTGAAAACATATAGG + Intergenic
1128634569 15:69294757-69294779 AAAGGAGGGTAAAGACATATAGG - Intergenic
1129104632 15:73297765-73297787 AAAGCTGTGTGCAGACCTCTGGG + Intronic
1129927726 15:79381044-79381066 AAATCTGCCTGAAAACAGATTGG - Intronic
1130226787 15:82065166-82065188 AAAGCTGAGTCAAGAAATAGGGG + Intergenic
1132173446 15:99687806-99687828 AAAGCTACTTGAAGACCTGTAGG + Intronic
1133447159 16:5871536-5871558 CAAGCTGCGTGACGATAAATAGG - Intergenic
1137314100 16:47298946-47298968 AAAGCTGAGTAAAGCCAGATTGG + Intronic
1138785986 16:59847290-59847312 AAGACTAGGTGAAGACATATTGG - Intergenic
1138855162 16:60681865-60681887 AAAGCTGAGTGAAGAGATATAGG - Intergenic
1138973237 16:62171171-62171193 AAAGCTGAGTGAAGACAGCCCGG - Intergenic
1140684309 16:77418542-77418564 GAAGCTGTCTGGAGACATATTGG - Intronic
1142794615 17:2298259-2298281 AAATTTAGGTGAAGACATATGGG - Intronic
1143859476 17:9877904-9877926 AAAACTGAGTGAAGAGACATGGG + Intronic
1144497070 17:15754393-15754415 AAATATGTGTGGAGACATATTGG + Intergenic
1144874650 17:18391055-18391077 AAAGCTGGGTTAAGACATCTGGG - Intergenic
1144904562 17:18630532-18630554 AAATATGTGTGGAGACATATTGG - Intergenic
1157965077 18:52199511-52199533 AAAGCTGGGTGACACCATATGGG - Intergenic
1158144289 18:54293828-54293850 GAAGCTGCTTGAAGACTTCTTGG - Exonic
1159722601 18:71911336-71911358 AAAGCAAAGTGAAGACATTTTGG + Intergenic
1159813974 18:73050705-73050727 AAAGCCTAGTGAACACATATGGG + Intergenic
1160132529 18:76239446-76239468 AAAGGGGCATGAAGACATTTTGG + Intergenic
1162544968 19:11323738-11323760 AAAGCTGCAGGAAGTCATTTTGG + Exonic
1163326414 19:16606246-16606268 AAAGCAGCCTGAAGACACAATGG + Intronic
1163976770 19:20860173-20860195 AACTCTGTGTGAAAACATATTGG + Intronic
1165466261 19:35976859-35976881 CAAGCTGCCTGAGGACATATTGG + Intergenic
1166504077 19:43360741-43360763 AAAGCTGCAGGAATACAGATGGG - Intronic
1166506380 19:43374017-43374039 AAAGCTGCAGGAATACAGATGGG + Intergenic
925709021 2:6719578-6719600 ATAGCTGCGTGCAGGCTTATAGG - Intergenic
927068498 2:19498614-19498636 AAAGCAGCCAGAAGACACATAGG - Intergenic
928993427 2:37260288-37260310 AAAGCTGCATGGAGATATGTTGG - Exonic
929881632 2:45841986-45842008 AAAGCTCTGTGTAGACAGATGGG + Intronic
931149050 2:59552282-59552304 AAAGCTGTGTGAAGAGAGAAAGG + Intergenic
931664712 2:64601901-64601923 AAAGGTGCTTGAAGACATGATGG + Intergenic
934909162 2:98234831-98234853 AGAGCTGCGTGTAGATATGTTGG + Intronic
938858027 2:135335753-135335775 TATGCTGTGAGAAGACATATTGG - Intronic
940182126 2:150946343-150946365 AAAGCATAGTGAAGACATAAAGG + Intergenic
1169470797 20:5883994-5884016 AAAACTGCTTGAAGCAATATGGG - Intergenic
1171172177 20:23025265-23025287 AAAAGTGCGTATAGACATATAGG - Intergenic
1171568588 20:26221737-26221759 AGAGTTGAGTGAAGACAAATAGG - Intergenic
1171794559 20:29556725-29556747 AAGGCTGCAGGAAGAGATATTGG - Intergenic
1171853891 20:30327542-30327564 AAGGCTGCAGGAAGAGATATTGG + Intergenic
1173942682 20:46925105-46925127 AAAGCTGCATGAAGACATACAGG - Intronic
1180701120 22:17781918-17781940 AAGGCTGCTTGAAGCAATATGGG - Intergenic
1184983841 22:48115640-48115662 GAAGCTGCGTGAAGGCACAGGGG - Intergenic
951630716 3:24716887-24716909 AGTGCTGTGTGAAGCCATATTGG + Intergenic
954883363 3:53851075-53851097 AAAGCTTCGTGACGTCATCTGGG - Intronic
956059097 3:65331859-65331881 AAAGCAGTGTGAGGACATAGCGG - Intergenic
957110254 3:75946616-75946638 AGAGTTGAGTGAAGACAAATAGG + Intronic
958125057 3:89345449-89345471 AAATCTGGGTGAAGGTATATAGG - Intronic
960035411 3:113097582-113097604 AAGGCTGAGTGAAGACTTTTGGG - Intergenic
971046390 4:22809871-22809893 AAAGCTGTTTGAAGCCAGATGGG + Intergenic
979025166 4:115562405-115562427 ATGGCTTTGTGAAGACATATAGG - Intergenic
979827118 4:125251719-125251741 AAAGATGCATAAAGACCTATAGG + Intergenic
980631380 4:135439466-135439488 AAATCTGCTAGAAGCCATATTGG - Intergenic
981028611 4:140101049-140101071 GAAGGTGAGTGAAGCCATATTGG + Intronic
981116186 4:140993661-140993683 CAAGCTGCGTGAAGACCTTAGGG - Intronic
982964032 4:161879400-161879422 AAAGCATCGTGAAGAAATTTAGG - Intronic
984309623 4:178040638-178040660 AAAGGACCGTGAAGACAAATGGG - Intergenic
985005162 4:185527523-185527545 GAAGCTGGGTGAAGACAACTGGG + Intronic
985021465 4:185695788-185695810 AAAGCAGCATGTTGACATATAGG - Intronic
986815533 5:11405691-11405713 AAAGCTGAGGGAAAACACATAGG - Intronic
987313462 5:16702120-16702142 AAGGCTGCGTGAGGACACACTGG + Intronic
987584671 5:19839389-19839411 AAAAATGCATGTAGACATATAGG - Intronic
988939380 5:36127577-36127599 AAAGCTGACTGAAGAGATCTTGG + Intronic
998215156 5:140232495-140232517 AGAGCTGAGTGAAGATGTATTGG + Intronic
1007352061 6:41281150-41281172 AAACCTGCAAGAAGACACATTGG + Exonic
1011900791 6:92293856-92293878 AATGCTGAGTGAAAAGATATTGG - Intergenic
1012375205 6:98553945-98553967 AAAGCTGAGAGAAGAGAGATTGG + Intergenic
1017502099 6:155035035-155035057 AAAGCTTCGTGGACCCATATAGG - Intronic
1020617634 7:10479164-10479186 AAAGCTTAGGGAAGAAATATAGG - Intergenic
1022304428 7:29133003-29133025 TTAGCTGTGTGAAGACATTTTGG - Intronic
1025951099 7:66146079-66146101 AGAGCCGCGTGAAGAAATAATGG - Intronic
1028170049 7:87585237-87585259 AAAGCTTCAAGAAGAAATATAGG - Intronic
1028464310 7:91132777-91132799 AACTTTGCGTGAAGCCATATGGG + Intronic
1029895702 7:103981676-103981698 ATAGCTGCCTGAAGATATAAAGG + Intronic
1030415936 7:109242633-109242655 AAAGGTGCCAGAATACATATTGG + Intergenic
1032235165 7:130115274-130115296 AAAGATGCTTAAATACATATTGG - Intronic
1034049526 7:147967721-147967743 ATATCTACGTGAAGAAATATTGG + Intronic
1040809518 8:51436096-51436118 AAAGCTGGGTCAAGACAAAAGGG - Intronic
1042069982 8:64921631-64921653 AAAGCTGCTAGAAGACATACAGG - Intergenic
1044711739 8:95065060-95065082 AGAGCTGCATGGTGACATATGGG - Intronic
1046234040 8:111398094-111398116 ACAGCTGCAGGAAGACGTATGGG - Intergenic
1052495815 9:29222391-29222413 AAATCTGGGTGAAGATATGTTGG - Intergenic
1053386138 9:37691524-37691546 AAAGCTGAATGAAGGGATATGGG + Intronic
1059105131 9:111504386-111504408 AAAGCTGCATAAAGAGAAATTGG + Intergenic
1061377344 9:130234340-130234362 AAGCCTCCGTGAAGACATGTGGG - Exonic
1062327469 9:136019122-136019144 GAGGCTGCGTGAAGACATTGAGG - Intronic
1189217790 X:39342079-39342101 GAAGTTGCCTGAAGACATACAGG - Intergenic
1189744049 X:44151573-44151595 AAAGCTGCGTGAAGACATATTGG - Intronic
1195497548 X:105554492-105554514 AAAATTATGTGAAGACATATTGG - Intronic
1196368909 X:114953554-114953576 AAAGCTACTTGAAGAAATAATGG - Intergenic
1198756095 X:139984252-139984274 AAAGCTGGGTGAAGACTGATAGG - Intergenic
1200919361 Y:8599426-8599448 AGAACTCCGTGAAGGCATATGGG + Intergenic