ID: 1189745718

View in Genome Browser
Species Human (GRCh38)
Location X:44166974-44166996
Sequence TTTTAGAAAGAGCACTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 1, 2: 7, 3: 69, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189745718_1189745720 21 Left 1189745718 X:44166974-44166996 CCACCACAGTGCTCTTTCTAAAA 0: 1
1: 1
2: 7
3: 69
4: 368
Right 1189745720 X:44167018-44167040 TCTTGCCTGCAATCCTCCAGTGG 0: 1
1: 0
2: 1
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189745718 Original CRISPR TTTTAGAAAGAGCACTGTGG TGG (reversed) Intronic
901148149 1:7082124-7082146 TTTTAGAAACATCACTCTGGTGG - Intronic
901277799 1:8006225-8006247 TCTTAGAGAGAGAGCTGTGGGGG - Intronic
901872635 1:12147022-12147044 TTTCAGGAAGAACACAGTGGTGG + Intergenic
902082888 1:13833372-13833394 TTTTGGAAAGGGCAGTGTAGGGG - Intergenic
904709845 1:32421918-32421940 TTTTAGAAAGTGCACTATCTTGG + Intergenic
905195409 1:36272609-36272631 TTTTAGACAAAGCAGTGGGGTGG - Intronic
905203024 1:36326609-36326631 TTTTGGAAAGATCCCTGTGGTGG + Intronic
905466697 1:38159797-38159819 TTTTAAAAAGATCACCTTGGTGG + Intergenic
905608047 1:39321890-39321912 TTTTAGAAAAAGTATTCTGGTGG + Intronic
905744275 1:40400802-40400824 TTTTAGAAAGATTATTCTGGTGG + Intronic
906063572 1:42963638-42963660 TTTTAAAGAGACCAGTGTGGTGG - Intergenic
906114895 1:43349769-43349791 TTTTAGAAAGATTATTCTGGTGG - Intronic
906798279 1:48714620-48714642 TTTCAGAAGGACCACTCTGGTGG - Intronic
907035891 1:51215854-51215876 TTTTAGAAACAGCAATCTGGTGG - Intergenic
907431497 1:54414691-54414713 TTTTGGAAAGAGCTCTGTGAAGG + Intergenic
907520572 1:55020839-55020861 CCTTGGACAGAGCACTGTGGAGG + Intergenic
907992893 1:59600012-59600034 TATTAGAAAGATCATTGTGGTGG + Intronic
908238574 1:62170265-62170287 TTTTAAAAAGCCCACTGTGGTGG - Intergenic
908789168 1:67764354-67764376 TTTTAGTAAGAGCAATGTTTTGG - Intronic
908881712 1:68740132-68740154 ATTAAGAAAGAACACTTTGGGGG - Intergenic
908889549 1:68828826-68828848 TTTTACAAAGATAACTTTGGAGG + Intergenic
909575365 1:77170096-77170118 TTTAAGGAAGATCACTCTGGGGG - Intronic
910795934 1:91097560-91097582 TTTTAAAAAGAGAACAGAGGTGG - Intergenic
911721908 1:101200258-101200280 TTTTTAAAAGACCACTCTGGTGG - Intergenic
912359135 1:109080256-109080278 TTTTAAAAAGATCACTTTTGCGG + Intergenic
913284551 1:117214563-117214585 TTTTAGAAAGATCATTCTAGTGG - Intergenic
916206972 1:162324498-162324520 ATTTAGAAAGTGCTGTGTGGTGG + Intronic
916628290 1:166583440-166583462 TTTTAGAAAGTCAACTCTGGTGG - Intergenic
916824416 1:168430249-168430271 TTTGACACATAGCACTGTGGTGG + Intergenic
916860776 1:168802678-168802700 TTTTGGAAAGAGCATTCTGGTGG - Intergenic
918369479 1:183844976-183844998 TTTCAGAAAGACCAGAGTGGTGG - Intronic
918743367 1:188165858-188165880 TTTTAGAAACATCACTTAGGTGG - Intergenic
919937858 1:202266478-202266500 GTTGAGAAAGACCACTCTGGTGG - Intronic
920748661 1:208653111-208653133 TTCTAGAAAAAACACTGTGCTGG + Intergenic
922398209 1:225224372-225224394 TTTTAGAAAGTGCAGCCTGGGGG - Intronic
924062813 1:240193815-240193837 TTTTAGAAAGATAACTCTGGAGG - Intronic
924367768 1:243313998-243314020 TTTTAGAAAGAGCTCTGGGCTGG - Intronic
924715389 1:246567998-246568020 TTTTAAAAAAAACACTGTGGTGG + Intronic
1064038532 10:11936850-11936872 TTTCAGAAAGAGTATTATGGTGG - Intronic
1064040902 10:11962631-11962653 TTTTAGAAAGATTAGTATGGAGG - Intronic
1064547934 10:16469378-16469400 ATTTAGAAAGAGCGCTGTATAGG + Intronic
1065020549 10:21498921-21498943 TTTTAGATAGAGCACTGACAGGG - Intergenic
1065042813 10:21714874-21714896 TTTTATAAAGAGGACAGTGCAGG + Intronic
1066134143 10:32426630-32426652 TTTCAGAAAAAGCACCCTGGAGG + Intergenic
1067530314 10:47066340-47066362 ATGAAGAAAGAGTACTGTGGAGG - Intergenic
1068075138 10:52243439-52243461 TTTAAAAAAAAGCAATGTGGAGG + Intronic
1068853662 10:61774073-61774095 TAATAGAAAGAGCACTGGGTTGG - Intergenic
1069621372 10:69839480-69839502 TTTTCGATAGGGCATTGTGGGGG + Intronic
1070400244 10:76046873-76046895 TTTTAGAAACAGAACTATAGAGG + Intronic
1070693076 10:78542152-78542174 TTCTAGAAAGATCACTCTGTGGG - Intergenic
1071546129 10:86531223-86531245 TTTTAGAAATATCATTCTGGGGG - Intergenic
1072433161 10:95391441-95391463 TTTAAGGAACAGCAGTGTGGTGG - Intronic
1073739955 10:106394995-106395017 TTTTAGAGAGATCATTGAGGTGG + Intergenic
1074082620 10:110179701-110179723 TTTTAGAAAGAGCATTCTCAAGG - Intergenic
1074808249 10:117075880-117075902 TTTTAGAAAGATAACTTTAGAGG + Intronic
1075652532 10:124138384-124138406 TTTGAGAAAGTCCACTGTGGAGG + Intergenic
1077889348 11:6407518-6407540 TTTTTTAAAAAGCACTGTGCAGG - Intronic
1079151982 11:17908117-17908139 TTTTAGAAAGATCACTGTGATGG - Intronic
1079165194 11:18034341-18034363 TGTTAGAAAGAGCAATATGCTGG - Intronic
1079809329 11:24976175-24976197 TTGGAGACAGAGCACTTTGGGGG - Intronic
1079984165 11:27182921-27182943 CATTAGATAGAGCACTGTAGAGG + Intergenic
1080320500 11:31003813-31003835 TTTTAGAAAGAGCACAATGTAGG + Intronic
1080836915 11:35947823-35947845 AATTCGCAAGAGCACTGTGGAGG - Intronic
1081515776 11:43827520-43827542 TTTTAGAAATAAGATTGTGGAGG + Intronic
1083597462 11:63925151-63925173 TTTTAGAAAGATCACCCTGGAGG - Intergenic
1083680564 11:64349807-64349829 TGTTGGAGAGAGCACTGTGCTGG + Intronic
1083807270 11:65082184-65082206 TTTAAGAAAGACCCCTCTGGGGG - Intronic
1084024868 11:66441579-66441601 TATTAGAAAGAACACTGCAGAGG - Intronic
1085136935 11:74099479-74099501 TTTTACAAAGAGCACCTTTGTGG - Intronic
1085227569 11:74936256-74936278 CTTTACAAAGAGGACTGGGGTGG - Intronic
1085291418 11:75402748-75402770 CTTTACAAAGAGCCCTGTTGCGG + Intronic
1087902905 11:103662799-103662821 TGATAGAAAGAGCACTGGGCTGG + Intergenic
1088125184 11:106415774-106415796 TGTGAGCAGGAGCACTGTGGGGG + Intergenic
1088701351 11:112415330-112415352 TTTTAGAATCAGCACAGTAGAGG + Intergenic
1089009620 11:115121907-115121929 TTTTAGAAAGGCCACTTTGATGG + Intergenic
1089574706 11:119433232-119433254 TTTTCCAAAGTGCACTGTGTAGG + Intergenic
1089680925 11:120118481-120118503 TTTTAGAAAGATAGCTTTGGTGG - Intronic
1089845581 11:121455491-121455513 TCTGAGAAAGAGCCCTGTGCTGG + Intronic
1090983318 11:131743482-131743504 TTTTAGGAAGAGTACTATGAAGG - Intronic
1090988257 11:131792694-131792716 TTTCAGAAAGAGCAGTGTGAAGG - Intronic
1091363255 11:134995034-134995056 TTTTAGACAGAGGACTTTTGGGG - Intergenic
1091998320 12:5013122-5013144 TTTTAGGAAGATTACTGTGGTGG + Intergenic
1093592112 12:20915240-20915262 TATTAGATAGAGCACTGCTGAGG - Intronic
1094766093 12:33596284-33596306 CTTTTGAAACAGCACTGTGAGGG - Intergenic
1095034488 12:37343351-37343373 CTTTTGAAAGAGCAGTGTTGAGG - Intergenic
1095536502 12:43254589-43254611 TTTTTGAAAAAGCACTTTAGTGG - Intergenic
1095932886 12:47646832-47646854 TTTTAGAAAGATGAAGGTGGAGG - Intergenic
1097655774 12:62361068-62361090 TTTTTGAAAGAGAACAGAGGTGG + Intronic
1098318071 12:69212915-69212937 TTTTAAAAAGAATACTTTGGTGG - Intergenic
1099329089 12:81258988-81259010 CTTTAGAAATAGCACTGTGATGG - Exonic
1099876462 12:88412823-88412845 TGTTCTAATGAGCACTGTGGAGG - Intergenic
1100333140 12:93604530-93604552 TTTAAGAAAAAAAACTGTGGTGG + Intergenic
1100908693 12:99333048-99333070 TTTTAGAAACATCACTCTGGAGG + Intronic
1100951943 12:99860539-99860561 TTTTAGAAAGATCCCTCTGGAGG + Intronic
1101221549 12:102646621-102646643 TTTTAGAGAGACCACTCTGGAGG + Intergenic
1101546367 12:105717077-105717099 TTTTGGAGAGATCACTCTGGTGG + Intergenic
1101956414 12:109216180-109216202 TTTTAGAAAGGACACTGAGGTGG - Intronic
1102643076 12:114383561-114383583 TTTTACAAAGATCTCTTTGGTGG + Intronic
1102975314 12:117202726-117202748 TTTTAGGAAGGGCACTCTGGGGG + Intergenic
1102986941 12:117285888-117285910 TTTTTGCAAAAGCACTGTGTTGG + Intronic
1103320550 12:120090495-120090517 TTTTCCAAAGAGCACTGTGCTGG + Intronic
1104286548 12:127429862-127429884 TTTTACACTGAGCACTTTGGTGG - Intergenic
1105808805 13:23975599-23975621 TTTTAGAAAGAGAAGGTTGGAGG - Intergenic
1106499659 13:30315732-30315754 TTATACATAGAGCACTGTGCTGG + Intergenic
1106618195 13:31349892-31349914 CTTTAGAAAGATTACTCTGGGGG - Intergenic
1106629025 13:31451380-31451402 TCTTAGAAAGAGAACTGGAGTGG + Intergenic
1106695524 13:32168485-32168507 GTTTATATAGAGCTCTGTGGTGG - Intronic
1107054711 13:36090549-36090571 TCTTAGAAAGAGCTCTCTGGAGG + Intronic
1107536133 13:41334910-41334932 TTTTGCAAAAAGCACAGTGGGGG - Intronic
1107621744 13:42239700-42239722 TTTTAGAGAGACCACTCTGGTGG - Intronic
1107635792 13:42390920-42390942 TTTTAGAAAGTGCACGTTGTTGG - Intergenic
1108378831 13:49837796-49837818 TTCTAGAAAAACCACAGTGGTGG + Intergenic
1108421442 13:50253772-50253794 CTTTCTAAAGAGCACTCTGGAGG - Intronic
1108495651 13:51022267-51022289 GTTTAGAATGATCACTCTGGAGG - Intergenic
1108582763 13:51840780-51840802 TTTTTGCAAGAACATTGTGGGGG - Intergenic
1111151793 13:84263013-84263035 TTTTAGAAAAATCACTGTAATGG + Intergenic
1111572872 13:90109433-90109455 TTTTAGAAAGATAAATGTGTGGG - Intergenic
1112968704 13:105232237-105232259 CTTTAGGACGAGCACTGTGTTGG - Intergenic
1113055559 13:106263279-106263301 TTTTTGAAAGATCACTGGAGCGG - Intergenic
1115678687 14:35711770-35711792 TTTTAAAAAGAGGACTTGGGTGG - Intronic
1115816387 14:37168758-37168780 TGTGAGAAAGAGGACTGAGGAGG + Intronic
1118799698 14:69178316-69178338 TTTTAGAAAGATAAGTCTGGAGG + Intergenic
1119409345 14:74420006-74420028 TTTTAGACAGAGCACTCTGATGG + Intronic
1119919990 14:78437949-78437971 TTTTAGAAAGATCTTTCTGGTGG + Intronic
1120017341 14:79488822-79488844 TTTTAGAATGATCTCTTTGGGGG + Intronic
1120020786 14:79527330-79527352 TTTAAGGAAGAGTAGTGTGGCGG + Intronic
1120067027 14:80054511-80054533 TTTTAGGAAGAGGACTTTGTGGG + Intergenic
1121474756 14:94187850-94187872 TTTTAGGAAGAGTACCATGGTGG + Intronic
1124066735 15:26351667-26351689 TTTGAGTAAGAGAAATGTGGTGG + Intergenic
1124070810 15:26391497-26391519 TTCTAGATAGAGCAATGTGCTGG + Intergenic
1125270746 15:37936075-37936097 TGTTAGATTGAGCACTTTGGAGG + Intronic
1125562880 15:40651677-40651699 TTTTTGAAACAGCACTGTATAGG - Intronic
1126351439 15:47748832-47748854 TTTTAGAAAGATCATTCTGGTGG + Intronic
1126473432 15:49041498-49041520 TTCCGGAAAGAGCACTGTGCTGG + Intronic
1126634521 15:50767778-50767800 TTTTAGAAAGCTCTCTATGGTGG + Intergenic
1127341001 15:58044042-58044064 GTTTAGAAAAAGCACTGAGGTGG - Intronic
1128835065 15:70802895-70802917 TGCTGGAAAGAGCACTGTTGTGG - Intergenic
1129451953 15:75656168-75656190 TTTTAGAATCAGCAGTGTGATGG + Intronic
1129916454 15:79277765-79277787 TTTCATAAAAAGCACTGTGATGG + Intergenic
1129991261 15:79965434-79965456 TTTTAAAAATATCGCTGTGGGGG + Intronic
1130203982 15:81858892-81858914 TTTTCTAAAGAGCAGTGTGTGGG - Intergenic
1130436594 15:83905633-83905655 TTTTTGAAAGATCCCTCTGGTGG + Intronic
1130447362 15:84015653-84015675 TTTTGGAAAGAGCCACGTGGTGG - Intronic
1131236327 15:90699969-90699991 TTTTAGAAGGAGTGCTGAGGTGG + Intergenic
1131358209 15:91765086-91765108 TTTGGGAAAGAGCTCTGTGTGGG - Intergenic
1132158494 15:99514335-99514357 TTACAGAGAGAGCACTGTGGAGG - Intergenic
1135636479 16:24080088-24080110 CTTTTGAAAGATCACTTTGGTGG + Intronic
1135707736 16:24689302-24689324 CTTTAGGAAGAGCCCTCTGGTGG + Intergenic
1137466235 16:48712360-48712382 TTTTAGACAAAGTGCTGTGGAGG + Intergenic
1137542353 16:49373570-49373592 TTTTATTAAGATCTCTGTGGAGG + Intergenic
1137947371 16:52746950-52746972 TTTTAGAAAGATTACTCTGATGG - Intergenic
1138171062 16:54850021-54850043 GTTTAGAAAGATCAGTGTTGAGG - Intergenic
1138409790 16:56829843-56829865 TTTTAGAAAGAGTCCTGTTGAGG + Intronic
1141118256 16:81330223-81330245 TTCTAGAAACATCACTCTGGCGG - Intronic
1141450434 16:84096623-84096645 CTTTAGAAAGAGAACTGTATTGG - Intronic
1142217484 16:88837002-88837024 TTCTAGATAGAGCCCCGTGGAGG - Intronic
1143287684 17:5802376-5802398 TTTTAGAAAGATCCCTTGGGGGG - Intronic
1145082932 17:19910358-19910380 TTTAAATAAGAGCATTGTGGTGG - Intronic
1146585623 17:34079119-34079141 TTTTAGAAGTATCACTCTGGTGG - Intronic
1146974074 17:37096176-37096198 TTTTAGAAAGACCACTAAGGGGG - Intronic
1148990773 17:51665298-51665320 TATTAGAAAGAGCACAGGGCTGG + Intronic
1149402529 17:56312855-56312877 TTTTAGAAAAACAACAGTGGGGG + Intronic
1149462032 17:56836605-56836627 TTTTAGAAAGATCATTTGGGTGG - Intronic
1149633930 17:58150879-58150901 TCTTAGCATGAGCACTGTCGGGG - Intergenic
1150148511 17:62791255-62791277 GTTTGGAAAGAGCACTGGCGTGG + Intronic
1150453825 17:65291159-65291181 TTTGAGAAACAACACTGTAGAGG + Intergenic
1150492988 17:65587173-65587195 TTTTAGAAAGCTCCCTGTTGTGG + Intronic
1150610024 17:66726484-66726506 TTTCAGGAAGACCACTGTGGAGG + Intronic
1151066206 17:71152930-71152952 TTATGGAAAGAGCACACTGGTGG + Intergenic
1152222738 17:79077949-79077971 GTGTAGAAAGAGCACTGGGCGGG + Intronic
1153896935 18:9571900-9571922 TTTTAGAAAGACCATTCTGGAGG + Intronic
1154012097 18:10583040-10583062 TTTTAATAATAGCACTGAGGAGG + Intergenic
1154071517 18:11156441-11156463 TTTTAGTAAGGGGACTGTGATGG - Intergenic
1154240117 18:12645708-12645730 TTTTAGAAAGATAAATGTAGGGG - Intronic
1154498349 18:14978831-14978853 TGTTCAAAAGAGCACTGTGCAGG - Intergenic
1155448544 18:25938956-25938978 TTTTAGACAGGGCAATGTTGAGG - Intergenic
1155535151 18:26809300-26809322 TTTTAGAAAGACAATTCTGGGGG + Intergenic
1156088264 18:33435174-33435196 TTTTAAAAAGAGCAATTTTGGGG + Intronic
1156198825 18:34807257-34807279 TGTTAGAAAGGGCACTGTCCTGG + Intronic
1156709160 18:39920677-39920699 GTTTAGAAAGAAGACTGAGGGGG + Intergenic
1157912093 18:51625775-51625797 TTTTAGGAAGAACACTATGAAGG - Intergenic
1159251186 18:65879111-65879133 TTTTTGAAAGTACACTGAGGTGG + Intronic
1159881742 18:73864831-73864853 TTTTAGAAAAATTACTTTGGTGG - Intergenic
1160957806 19:1701682-1701704 TGGTGGAAAGAGCACTGTGCGGG + Intergenic
1161741127 19:6021823-6021845 TTTTAGCAGGATCACTCTGGTGG + Intronic
1162959195 19:14116453-14116475 GGTCAGAAAGAGCACTGGGGAGG - Intronic
1163169316 19:15519687-15519709 TGTTAGAAAGGGGATTGTGGTGG + Intronic
1163348182 19:16758068-16758090 TTTTGGAAAGAGTACAGTGTTGG + Intronic
1163492547 19:17625262-17625284 TGTTTGAAAGAACAGTGTGGGGG + Intronic
1165242501 19:34480118-34480140 TTTTGGGAAGAGCAGTTTGGCGG - Intergenic
1165979879 19:39711712-39711734 CTTTAGGAAGTGCACTGAGGTGG - Intergenic
926174109 2:10573816-10573838 TTTGAGACGGAGCACAGTGGAGG - Intronic
926256617 2:11207421-11207443 CTTGAGAAAGAGCCCTGAGGAGG + Intronic
926733216 2:16053067-16053089 TTTTGGAAAGATCACTTTGGTGG + Intergenic
926741651 2:16116238-16116260 TTTTAGAAAGCTCACCCTGGAGG + Intergenic
926983242 2:18593846-18593868 TTTTAGAAAGATCTCTTTAGTGG - Intergenic
927668648 2:25050418-25050440 TTTTAAAAAAAGCTCTGTGTGGG + Intronic
928450874 2:31377675-31377697 GGTTAGAGAGGGCACTGTGGAGG - Intronic
928466101 2:31524046-31524068 TTTTAGAAAGCGCCCTCTTGTGG + Exonic
930166629 2:48209757-48209779 TTTTAGAAAAAGCACTCTGAGGG + Intergenic
931099167 2:58976094-58976116 TTTGAGAAAGAACAATGAGGAGG + Intergenic
931514695 2:63041780-63041802 TTTTGTAAAGAGCACATTGGGGG - Intronic
932132136 2:69197283-69197305 TTTTACAAGGAGCACTGTGGTGG - Intronic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933781685 2:85807017-85807039 TTTTGGAAAGATCACTTTGGTGG + Intergenic
935051680 2:99530055-99530077 TTTTACAAAGAGGAGTCTGGAGG + Intergenic
935141074 2:100353578-100353600 TTTTAGAAAGAGCTCTGCACTGG + Intergenic
936021517 2:108998609-108998631 TTTTAGATAAATCACTGTAGAGG - Intergenic
936022450 2:109005249-109005271 TTTTAGAAAGATTAGTCTGGAGG - Intergenic
936152421 2:110029113-110029135 TCCTAGAAAGAGCACTGGGAGGG - Intergenic
936192258 2:110342299-110342321 TCCTAGAAAGAGCACTGGGAGGG + Intergenic
937906765 2:127056298-127056320 ATGTAGGAAGAGCAGTGTGGGGG - Intronic
938150122 2:128875270-128875292 TTTAAGAAAGAGCACAATGTGGG - Intergenic
939221967 2:139313860-139313882 TTTTGGAAAGAACACTCTTGTGG - Intergenic
939874469 2:147561736-147561758 TTTTTCAAAGAGCAGTGTGATGG - Intergenic
939894911 2:147779837-147779859 TTTCAGAAAGAGCAATCTGGTGG - Intergenic
940212602 2:151271036-151271058 TTTTAGAAAGAGAACTCTGGTGG + Intronic
940286144 2:152034736-152034758 TGTTTAAAAGAGCACTGTGGGGG - Intronic
941279720 2:163534924-163534946 TTTTAGAAAGTGCTGTGTAGGGG - Intergenic
941671874 2:168302461-168302483 TTTTTGATATAGCACTGGGGAGG + Intergenic
942542665 2:177031029-177031051 TCTTAGAAAGAGCACTCAGTTGG + Intergenic
943440365 2:187920380-187920402 TTTTAGAAAGAGTATTATAGTGG - Intergenic
944469856 2:200041476-200041498 TTTTAGACAAATCACTGTGGTGG - Intergenic
945262848 2:207860808-207860830 TTTTAGAATGAAGACTGGGGAGG - Intronic
945288038 2:208101847-208101869 TTTTTAAAAGAGCTCTGTGTCGG - Intergenic
945326659 2:208490025-208490047 TTTTAAAAAGAGTAATGTAGTGG - Intronic
945728139 2:213498975-213498997 TTTTAGAAAGACTACTATGATGG - Intronic
946037787 2:216757542-216757564 GTTGAGAAAGATGACTGTGGTGG + Intergenic
946728242 2:222683370-222683392 TTTTAAAGAGAACACTCTGGTGG - Intronic
948162752 2:235838340-235838362 TTTTAGCAAAATCACTTTGGAGG - Intronic
948440531 2:237984274-237984296 TCTTAGAAAGGGCAAAGTGGAGG - Intronic
948543836 2:238711374-238711396 TTAGAAACAGAGCACTGTGGGGG + Intergenic
1169049734 20:2565660-2565682 TTTTAGAAATAGTAGTGTGGGGG + Intronic
1169351909 20:4874868-4874890 TTTTGGAAATACTACTGTGGGGG + Intronic
1170802547 20:19602409-19602431 TTATAGCAAGGACACTGTGGGGG - Intronic
1170985221 20:21251662-21251684 TTTCAGAAAGAACACTATAGAGG - Intergenic
1172092419 20:32443363-32443385 TTTTATAGAGAGCATTGAGGAGG + Exonic
1172689576 20:36781196-36781218 TCTTAAAAAGAGCACTGAGCAGG - Exonic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1172985952 20:38989411-38989433 TCTTTGAAAGAGCCCTGTGTCGG - Intronic
1173434338 20:43019160-43019182 TTGTAGAAAGATCATTGTGATGG + Intronic
1174464555 20:50707234-50707256 TTTTAGAAGGATCACTGTGGAGG + Intergenic
1175336299 20:58198518-58198540 TTTTGGAAAGATCACCCTGGTGG + Intergenic
1177763482 21:25429993-25430015 TTTTAGAAATATCACTTTGGAGG - Intergenic
1178427451 21:32490466-32490488 GATTAGAAAGACCACAGTGGAGG + Intronic
1180639427 22:17286514-17286536 TTTTTGAAAGAGCTCCGTGGTGG + Intergenic
1183593657 22:38796592-38796614 TTGTGGAAAGATCACTCTGGTGG + Intergenic
1183789227 22:40051546-40051568 TTTCAGGAAGATCAGTGTGGGGG - Intronic
1183856526 22:40638389-40638411 TTTGAGTAAGAACACTGAGGGGG + Intergenic
1184126419 22:42490635-42490657 CTTTTGAAAGGGCACAGTGGGGG - Intergenic
949449693 3:4171991-4172013 TTTTAGAAAGATCACATTGAAGG + Intronic
949980050 3:9496775-9496797 TTTTAGAAAGAGCACTCTGGTGG - Intergenic
949996086 3:9618679-9618701 AGTTAGAAAGAGCACAGAGGAGG + Intergenic
951053817 3:18124473-18124495 TTTAAGAAAGGTCAGTGTGGAGG + Intronic
951114914 3:18848283-18848305 ATTTAGAAAGAAATCTGTGGAGG + Intergenic
951274517 3:20669302-20669324 TTTTAGAAAGAGCAAAGCAGAGG + Intergenic
955072786 3:55585629-55585651 TGTTAGAGAGAGCTCTTTGGGGG + Intronic
955291320 3:57694789-57694811 TATTAGAAAGAACACTGGCGTGG + Intergenic
955930775 3:64054644-64054666 TTTTAGAAAGATCTTTCTGGTGG - Intergenic
956309937 3:67867717-67867739 TTTAATAAAGACCACTATGGTGG - Intergenic
956504077 3:69919142-69919164 CTTTGGAAAATGCACTGTGGTGG - Intronic
956555823 3:70521389-70521411 ATTTAGAAAGGGCATTCTGGTGG - Intergenic
956616083 3:71174221-71174243 TTGTAGAAAGATTACTGTGGAGG + Intronic
959243479 3:103830703-103830725 TTTTAGAATGATCACTGTGTTGG - Intergenic
961172950 3:124811891-124811913 GATTAGAAAGAGCCCTGGGGTGG - Intronic
962825712 3:139099484-139099506 TTTCAGGAAGAGAACTGTGTTGG - Intronic
963652247 3:147994572-147994594 TCTTAGAAGGAGCACTCTTGGGG + Intergenic
963970667 3:151426138-151426160 TTTTGGAATCATCACTGTGGTGG - Intronic
964009779 3:151878090-151878112 TATTGGAATGAGCAATGTGGAGG + Intronic
964541968 3:157789665-157789687 TTTTAGAAAGATGACCTTGGCGG - Intergenic
964929083 3:161993793-161993815 TTTTGGATTGAGCACAGTGGTGG + Intergenic
966226962 3:177608282-177608304 TTTTAGAAATAGAACAGAGGAGG - Intergenic
966566256 3:181384806-181384828 TTTTAGAAAGATCACTTAAGCGG - Intergenic
966605946 3:181821881-181821903 TTTTAGAAAGATCTCTCTGCCGG + Intergenic
967125331 3:186418439-186418461 TTCTAGAATGACCACAGTGGTGG - Intergenic
968826136 4:2898848-2898870 TTTTTCAAAGAGTACTGTGGGGG - Intronic
969049217 4:4360744-4360766 TTTGCGAAAGAGCACTGAGGGGG + Intronic
970298144 4:14653463-14653485 TTTTAGAAAGGGAAGTGAGGAGG + Intergenic
971276640 4:25204613-25204635 TTTTAGAAAATGTACTATGGAGG + Intronic
971433158 4:26589920-26589942 ATCTACAAAGAGCACTCTGGTGG - Intronic
971798886 4:31262523-31262545 TTTTAGAAAGACCACTTTTGGGG + Intergenic
972576928 4:40360358-40360380 TTTAAGAAATAAGACTGTGGTGG + Intergenic
972653798 4:41046861-41046883 TTTCTGAAAGAGCACTGGAGTGG + Intronic
973096660 4:46210463-46210485 ATTTAGAAAGACCACTCTGCTGG + Intergenic
975947696 4:79727728-79727750 TTTTAAAAAGGGCCCAGTGGGGG - Intergenic
976774105 4:88688355-88688377 TTTTAGAAAGATTACTTTGGGGG + Intronic
976839552 4:89415361-89415383 TTTTAGAAAGATTACTCTAGTGG + Intergenic
977720408 4:100233477-100233499 TTTAAGAAAGAGCAATGTTCAGG - Intergenic
978037529 4:104014075-104014097 TTTTAGGAAGATAACTCTGGTGG + Intergenic
979311628 4:119210713-119210735 CTTTAGAAAGATTAATGTGGAGG + Intronic
980066842 4:128198736-128198758 TTTTAGGAAGATAACTTTGGTGG + Intronic
980619468 4:135279805-135279827 TTTTAGAAAAAGAAATGAGGAGG - Intergenic
980640112 4:135566132-135566154 TTTTGTAGAGAACACTGTGGTGG + Intergenic
981938414 4:150257281-150257303 TATTAAAAAGAGCAGGGTGGTGG - Exonic
984226914 4:177046135-177046157 TTTTAGAAAGATCATTCTAGAGG + Intergenic
984833813 4:184000459-184000481 TTTCAGAAAGATGACTGTGGTGG - Intronic
985712089 5:1435277-1435299 GTTTCCAGAGAGCACTGTGGAGG + Intronic
987230069 5:15884791-15884813 TTTTAGAAAGGGCAAAGCGGTGG + Intronic
987822658 5:22985483-22985505 TTTTAAAAAGTGCAATGTAGTGG + Intergenic
988315422 5:29620475-29620497 TTTTATATAGAGAACTTTGGTGG + Intergenic
988771605 5:34438511-34438533 TTTTAGAAAGGCCTCTGCGGTGG + Intergenic
988858266 5:35250553-35250575 TTTAAGAAAATGAACTGTGGAGG + Intergenic
990072127 5:51796022-51796044 TTTTTGAAAGAGATCTGGGGTGG + Intergenic
990424117 5:55668200-55668222 TTATAGAGAGAACTCTGTGGGGG + Intronic
990626162 5:57613662-57613684 TTTTCAAAAGAGCACTGAAGAGG + Intergenic
992168514 5:74078354-74078376 TTTTAAAAAGAGCAGCCTGGTGG - Intergenic
993059849 5:83026056-83026078 TTTTAGAACGATCATTCTGGGGG + Intergenic
993300667 5:86205527-86205549 TTTTAGAAACAGCACTTTCCTGG + Intergenic
993611560 5:90060629-90060651 GTTTTGAAAGATCACTCTGGTGG - Intergenic
995401218 5:111744141-111744163 TTTTGGAATGAGCACTTCGGGGG - Intronic
996029520 5:118689440-118689462 TTTTGGAAAGATCACTCTGCTGG + Intergenic
998106622 5:139473064-139473086 TTATAGAGAGAGCCCTGTGGTGG + Intergenic
998132613 5:139659038-139659060 TTTCAGGAAGAGCACAGTGGGGG + Intronic
998698101 5:144664157-144664179 TTTTAGAAAAAGACCTATGGAGG - Intergenic
999038619 5:148382595-148382617 TTTTGTAAAAAGCACTGTAGTGG - Intergenic
999266142 5:150268165-150268187 TTTTAAAAAGAGCTCCTTGGTGG - Intronic
999676769 5:154012029-154012051 TTTTAGAAAGATCACTTTGGTGG + Intronic
999733869 5:154498048-154498070 TTGTAGGAAGAGCACCCTGGTGG - Intergenic
1000962697 5:167618966-167618988 TTTTAGAAAGACAATTGGGGTGG + Intronic
1001224858 5:169935040-169935062 TAATAGAAAGAGCACTGGAGAGG + Intronic
1002179777 5:177425208-177425230 TTTTAAAAATATCACTCTGGTGG - Intronic
1003340378 6:5214516-5214538 TTTGAAAAAGATCACTGTGGTGG + Intronic
1003428551 6:6017426-6017448 TTTTGGAAAGAAGACTGTGGAGG + Intergenic
1003477730 6:6499616-6499638 TTTTAAAAACAGCACTGTGGAGG + Intergenic
1003807659 6:9743915-9743937 TATTAGATAGATCACTGAGGTGG - Intronic
1004307618 6:14515241-14515263 TTTCATAAAGCGCACTGTGCTGG - Intergenic
1004871001 6:19903782-19903804 TCTAAGAAAGAGTACTGTGCTGG + Intergenic
1005049233 6:21667788-21667810 TTGTAGAAAAAGCATTTTGGGGG + Intergenic
1005822234 6:29607438-29607460 TTTTAGCAAGATCACCCTGGTGG - Intronic
1006252372 6:32798549-32798571 TTTTAGAAAGACTACTCTGATGG + Intergenic
1007168163 6:39843172-39843194 GTATGGAAAGAGCACTGCGGGGG + Intronic
1007192195 6:40028939-40028961 AGTTAGAAAAAGCACTTTGGGGG + Intergenic
1008369774 6:50719080-50719102 TTTTATTAAGGGCTCTGTGGAGG + Exonic
1008441995 6:51542369-51542391 CTTTCTAAAGAGCACAGTGGGGG - Intergenic
1010106553 6:72176201-72176223 TTTTAGAAATTGCACTATGCAGG - Intronic
1010255241 6:73749895-73749917 TTTTAGGAAGATCACTTTGGTGG + Intronic
1010831831 6:80540760-80540782 TATAAGAAACAGCACAGTGGTGG + Intergenic
1011016523 6:82762207-82762229 TTTCAGAAGGAGTACTATGGTGG + Intergenic
1011560357 6:88607687-88607709 GTTTTGAAAGATCACTCTGGTGG + Intergenic
1011793586 6:90927455-90927477 TTTTAGAAGGATCACTCTGGTGG + Intergenic
1012267781 6:97167487-97167509 TTTTAGAAAGATGATTCTGGTGG - Intronic
1012479677 6:99652630-99652652 TTTTAGAAAGATCTCTCTGATGG - Intergenic
1013349698 6:109294110-109294132 TTTTAGCCAGAGCTGTGTGGGGG - Intergenic
1013862822 6:114657512-114657534 TGGTATAAAGAGCAATGTGGAGG + Intergenic
1014399890 6:120975329-120975351 ATTTAGAAATAGCACTCTGGTGG - Intergenic
1015115837 6:129648457-129648479 TTTTAGAAAGTGCACTGGACAGG - Intronic
1015367235 6:132409783-132409805 TGTTAAAAAGGGCATTGTGGGGG + Intergenic
1015416632 6:132956534-132956556 ACTTAGCAATAGCACTGTGGAGG - Intergenic
1015760772 6:136658038-136658060 CTTTAGAAAGATCCCTGGGGAGG + Intronic
1016033937 6:139366380-139366402 TCTTAGAAAGAGCACTGACTCGG + Intergenic
1016488113 6:144565749-144565771 TTTTGGAAAGAGCAATTTGGAGG + Intronic
1018167798 6:161115964-161115986 TTTTAGAAAGATCACTCTAGAGG + Intronic
1018496330 6:164349040-164349062 ATTTAGGAAGAGCACTGTGAAGG - Intergenic
1021076636 7:16312623-16312645 ATTGAAAAAGAGCACTGAGGAGG + Intronic
1021244734 7:18247166-18247188 TTCTAGAAAGAGTTCTGTTGTGG + Intronic
1021250602 7:18320787-18320809 TTGTGGAAAGAGCACTGGGCCGG + Intronic
1021730039 7:23587020-23587042 TTGTTGAAAGAGCACTGAGAAGG - Intergenic
1021848250 7:24783612-24783634 TTTTAGAAAAATCACTCTGGTGG + Intergenic
1022513062 7:30953892-30953914 ATATATAAAGAGCACTGTGATGG - Intronic
1022836644 7:34123081-34123103 TTTTAGAAATAAAATTGTGGGGG - Intronic
1024092401 7:45955214-45955236 TTTTAGAAAGAACTCTTTGTAGG + Intergenic
1026097940 7:67361659-67361681 TTTTACAAATAAAACTGTGGTGG + Intergenic
1026216900 7:68357702-68357724 TTTTAGAAAGATCATTTTGTTGG + Intergenic
1027644398 7:80779048-80779070 TGTTATAGAGAGCACTGTGCTGG - Intronic
1027743186 7:82038774-82038796 TTTTAGAAATATCACTTTAGAGG + Intronic
1028357467 7:89926541-89926563 TTTTAGAAAGATCACGGCTGGGG - Intergenic
1028752716 7:94399384-94399406 TGTTAAAAAGAGGACTGTGGTGG - Intronic
1028913871 7:96237571-96237593 TTTTAGAAAAAGAACTGGTGTGG + Intronic
1029882919 7:103835879-103835901 TTTTAGAAAGATCACTCTGGTGG - Intronic
1030840570 7:114348601-114348623 TTATAGAAAGAACACTGTCCAGG + Intronic
1030895168 7:115050766-115050788 TTTTAGAAAGATCATTCTAGTGG + Intergenic
1031848784 7:126838230-126838252 TTTTAGAAATAGCATCTTGGGGG + Intronic
1031957063 7:127953362-127953384 TTTTAGAATGAGAAGTGTGTGGG - Intronic
1032448013 7:132001267-132001289 TTTTAGAAAGATAATTCTGGTGG + Intergenic
1032809746 7:135400314-135400336 TTTTAGAAAGATTAATTTGGTGG + Intronic
1033002079 7:137517063-137517085 TTTTAGAAAGAATACTGTAGAGG - Intronic
1034166898 7:149032197-149032219 TTTTATAAAGATCACTCTGGGGG + Intergenic
1035881139 8:3245039-3245061 TTTTAGAAGGTCAACTGTGGAGG + Intronic
1035995976 8:4547338-4547360 TTTTAGAAAGTTCACTGCTGTGG - Intronic
1036279453 8:7387317-7387339 TTTTAAGAATAGCACTTTGGAGG + Intergenic
1036342066 8:7924560-7924582 TTTTAAGAATAGCACTTTGGAGG - Intergenic
1036967227 8:13313815-13313837 TTTTATAAAGCTCAGTGTGGAGG + Intronic
1038928552 8:32167862-32167884 TTTCAAAAAGAGCAAGGTGGAGG - Intronic
1039217634 8:35290646-35290668 TTTTAAAAAAAGAAGTGTGGAGG + Intronic
1040832041 8:51688363-51688385 TTTTAGAAAGGGCATTCTGTTGG + Intronic
1041642887 8:60221534-60221556 TTTGAGAAAAACAACTGTGGAGG - Intronic
1041667986 8:60464676-60464698 TTTAAAAAACACCACTGTGGGGG + Intergenic
1042604057 8:70528491-70528513 TGTTAGAAAGGTCACTCTGGTGG + Intergenic
1042753044 8:72179266-72179288 TTTTATAATGACCACTGTGGTGG + Intergenic
1042903455 8:73749738-73749760 TTTTGGAAAGAACTCTGGGGTGG + Intronic
1043503178 8:80876008-80876030 TTTTAGAAAGAACAATGGGTTGG - Intergenic
1043674806 8:82937419-82937441 TGTTAGACACAGCAGTGTGGTGG - Intergenic
1043956078 8:86361111-86361133 CTTTAGAAGGATCACTGTGCTGG + Intronic
1044468974 8:92542861-92542883 TTTTAGAAATAGTACTTTGAAGG - Intergenic
1044471580 8:92575355-92575377 TTTTAGAAATAGAACTCTGTTGG - Intergenic
1045215849 8:100147591-100147613 TTTTAGAAAGTCCACTCTGGTGG + Intergenic
1045356860 8:101397046-101397068 TTTCAGAAAGAGCAATGCTGAGG + Intergenic
1045427158 8:102078377-102078399 TTTTTAAAAGATCACTGTGGTGG - Intronic
1047304547 8:123642345-123642367 TTTTAAAAAGATCACTCTGGCGG + Intergenic
1048054602 8:130851553-130851575 TGTTTGAAAGACAACTGTGGTGG + Intronic
1048133494 8:131722845-131722867 TTCTAGAAAGAGCATTGGAGAGG + Intergenic
1048288489 8:133161741-133161763 TTTTTGAAAGATCACCATGGTGG + Intergenic
1049046174 8:140153700-140153722 CTTTAGAAAAATCACTGTGCTGG - Intronic
1050390584 9:5139375-5139397 TTGTAGAAGGAGCAATGTAGGGG + Intronic
1052071597 9:24088718-24088740 TTGTTGAAAGTGAACTGTGGGGG + Intergenic
1053391459 9:37739390-37739412 TTTGAGAAAGATCACTCTGGAGG + Intronic
1053615773 9:39764536-39764558 TTTTTGAAAGAGCGGTGTTGAGG - Intergenic
1053898679 9:42770743-42770765 TTTTTGAAAGAGCGGTGTTGAGG + Intergenic
1054237747 9:62577854-62577876 TTTTTGAAAGAGCGGTGTTGAGG + Intergenic
1054551879 9:66612362-66612384 TTTTTGAAAGAGCGGTGTTGAGG + Intergenic
1055290927 9:74781054-74781076 TTTAAGAAAGAGAACTGGGCTGG + Intronic
1055704380 9:78981650-78981672 TATTAGAAAGAGCACTTGGATGG - Intergenic
1056112634 9:83410823-83410845 TTTTAGAAAGAGAATTTAGGAGG - Intronic
1056767375 9:89453213-89453235 CTTTATAAAGTGCACTGTGTGGG - Intronic
1059226468 9:112677671-112677693 TTTTTAAAAGATCACTCTGGAGG + Intergenic
1059705730 9:116821574-116821596 ATTTAGAAATAGCACTCTGTTGG - Intronic
1060404170 9:123364948-123364970 TTTTAGAAGGTCCACTCTGGTGG - Intronic
1060807461 9:126586647-126586669 TTTTAGAAAGACCTCGCTGGAGG + Intergenic
1061146935 9:128805500-128805522 TTTTAGTAAGTGCCCTGTGATGG + Intronic
1186335498 X:8582608-8582630 TTTTAGAAGGATCACTCAGGTGG + Intronic
1186472826 X:9834600-9834622 GTGGAGAAAGAGCACTGGGGAGG - Intronic
1186592893 X:10950221-10950243 ATTTAGAGAGATCACTGAGGGGG + Intergenic
1186933146 X:14416913-14416935 TTTTAAAAAGAGAGCTCTGGAGG + Intergenic
1188970609 X:36611119-36611141 TTTTTTAAATAGCACTTTGGAGG + Intergenic
1189075188 X:37906935-37906957 TTTTAGAAAAATCATTTTGGTGG + Intronic
1189745718 X:44166974-44166996 TTTTAGAAAGAGCACTGTGGTGG - Intronic
1190621499 X:52291770-52291792 TTTTAGAAATAGCTATGAGGTGG + Intergenic
1190733766 X:53241766-53241788 TTGTGGTATGAGCACTGTGGGGG - Exonic
1191731310 X:64338657-64338679 TCTTTGAAAGATCACTGTGGTGG + Intronic
1191882479 X:65856797-65856819 TTTAAGAAAGTGAAATGTGGGGG - Intergenic
1192105855 X:68316235-68316257 TTGTTGAAAGAGGACTGTTGAGG - Intronic
1192729269 X:73786183-73786205 TGTTAGAAACACCACTGTGCTGG + Intergenic
1192765617 X:74137085-74137107 TTTTAGAAAGTGCACTATCTTGG + Intergenic
1194653505 X:96543976-96543998 TTTTAGAAACAGTACTTTGTGGG + Intergenic
1196052856 X:111323788-111323810 TTTTAGGATGAGAAATGTGGTGG + Intronic
1196615910 X:117767080-117767102 TTTTAGAAATATCATTCTGGTGG + Intergenic
1196637277 X:118017077-118017099 TGCTAGAAAGATCACTTTGGTGG - Intronic
1197188669 X:123620056-123620078 GTTCATCAAGAGCACTGTGGTGG - Intronic
1197478607 X:126953771-126953793 TTTTAGATAGAAGCCTGTGGAGG - Intergenic
1199121200 X:144056067-144056089 TAGTAGAAAGTGGACTGTGGGGG - Intergenic
1199177161 X:144802798-144802820 ATTTAGAAAGAGAGCTATGGTGG - Intergenic
1199883288 X:151993879-151993901 TTTTAGAAAGTGGACTCTGAAGG + Intergenic
1200033141 X:153312332-153312354 CTATAGAAAGTGCAGTGTGGTGG + Intergenic
1200085187 X:153600686-153600708 TTTTAGAAAGCTCGCTCTGGCGG - Intergenic
1200385902 X:155890677-155890699 CTTTAGAAAGATCACTCTGGTGG + Intronic
1200849567 Y:7868984-7869006 ATTTACAATGAGCACTGTTGAGG - Intergenic