ID: 1189746614

View in Genome Browser
Species Human (GRCh38)
Location X:44174819-44174841
Sequence ATTTGCTAGCAGCCGTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189746614 Original CRISPR ATTTGCTAGCAGCCGTGTGA GGG (reversed) Intronic
900310645 1:2031744-2031766 CCTTGCGAGCTGCCGTGTGATGG - Intergenic
914874212 1:151500703-151500725 AATTGCCAGAAGCCGTGGGATGG - Intergenic
922007051 1:221541762-221541784 CTTTGCTAGCAGGAGTGTGAGGG + Intergenic
923971615 1:239208868-239208890 AATTGCTTGAAGCCGTGAGACGG + Intergenic
1064057823 10:12112642-12112664 CTTTGCTATCAGCCGTGTTTGGG + Intronic
1071136397 10:82459050-82459072 ATTTGGTAGCAGCCCTGCCATGG - Intronic
1073519883 10:104118128-104118150 ATTTTCTAGCTGCCTGGTGATGG + Intergenic
1075827155 10:125368691-125368713 ATTATCTAGCAGCAGTGTGCCGG + Intergenic
1080647980 11:34200830-34200852 TTTTAGTAGCAGCCATGTGATGG - Intronic
1086488494 11:87334148-87334170 ATATGCTAGCATCCTGGTGAGGG - Intergenic
1091298629 11:134490456-134490478 ATCTGCCTGCAGCCGCGTGAGGG - Intergenic
1099136659 12:78912485-78912507 ATTTCCTAGCAGCTCTGTGAAGG + Intronic
1108116687 13:47136345-47136367 ATCTGCTAACAGCAGTGCGAAGG - Intergenic
1111840384 13:93442246-93442268 ATTTTCTAGCAGCATTGTGCAGG + Intronic
1116067681 14:40004923-40004945 TCTTGATAGCAGCCTTGTGAGGG - Intergenic
1119659681 14:76441404-76441426 ATTTGATAACAGCCCTGTGGGGG - Intronic
1126136975 15:45402289-45402311 CGTTGCTAGCAGCTGAGTGAAGG - Intronic
1127102144 15:55577299-55577321 ATTGGCTAGCGGCGGGGTGAGGG - Intronic
1133450691 16:5901488-5901510 ATTGGCTAGCAAAGGTGTGAAGG - Intergenic
1147423157 17:40332414-40332436 GCTTGCCAGCAGCCGTGAGAGGG - Intronic
1151709837 17:75797641-75797663 CTTTGCCAGCTGCTGTGTGAGGG + Intronic
1158855325 18:61538409-61538431 CTTTGCTATCAGCAGTATGAAGG - Intronic
1161653823 19:5500950-5500972 ATTTGCTATCAGCTGTGCTAGGG + Intergenic
1165827616 19:38714200-38714222 GTTTGCGAGCAGCAGTGGGAGGG + Intronic
931625093 2:64250249-64250271 ATGTGCTAGAAGCCCAGTGAGGG + Intergenic
935708006 2:105873017-105873039 CTTTCCTGGCAGCCGGGTGAGGG - Intronic
940697055 2:156992938-156992960 ATTAGATAGCAGCCGTGTAGAGG + Intergenic
942918306 2:181339483-181339505 ACTTGCTAGAAGCAGAGTGAAGG - Intergenic
1169767570 20:9164333-9164355 ATTTGCATGCACCCTTGTGAGGG + Intronic
1173851557 20:46221696-46221718 ATTAGTAAGCAGCCGTGTGCAGG + Intronic
1174252667 20:49231150-49231172 CTTTGCTGGCTGCCCTGTGACGG + Intronic
1177049788 21:16218709-16218731 ATTTCATAGCTGCAGTGTGATGG + Intergenic
949836238 3:8273445-8273467 ATTATCTAGCAGCCTTGAGAGGG - Intergenic
951578784 3:24140388-24140410 ATTTGATGGCAGCTGTATGAGGG - Intronic
952512807 3:34074128-34074150 ATTTGCTAGCAGCTTTGCCAAGG - Intergenic
952805934 3:37352152-37352174 CTTTATTAGCAGCCGTGAGAAGG - Intronic
953891556 3:46755306-46755328 ATTTTCTAGCAGGTGGGTGAGGG - Intronic
957974639 3:87427480-87427502 ATTGGGTAGCATCCGTGTGTTGG + Intergenic
962265163 3:133939517-133939539 GTTTGCTAGCAGAACTGTGATGG - Intronic
965943125 3:174209452-174209474 ATTTGCTTGCCACTGTGTGATGG - Intronic
985066512 4:186127292-186127314 ACTTCCTAGCAGCAGTGTGCTGG - Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
1000929371 5:167232518-167232540 ATTAGCTAGCAGCAGTGGCAGGG - Intergenic
1001738472 5:174028096-174028118 AGTTTCTATCAGCAGTGTGAAGG - Intergenic
1001822617 5:174721580-174721602 ATCTGCTAGCAGCGGTGTGTTGG + Intergenic
1003817495 6:9858522-9858544 ATTTTCTAGCAGCAGTGTGGAGG + Intronic
1007098228 6:39227623-39227645 ATTTGCTGGCAGCCGTGTGTGGG - Intronic
1014032531 6:116722178-116722200 ATGTGTTAGCAGACGTGTGTTGG + Exonic
1015889267 6:137953137-137953159 ATTTGATAGAAGCAGTGTTATGG + Intergenic
1021514865 7:21473093-21473115 TTTTTCTGGCAGCAGTGTGAAGG + Intronic
1021849040 7:24790136-24790158 ACTTGCTAGCAGCTGGGGGAGGG - Intergenic
1024439013 7:49393555-49393577 CTTTACTAGCAGCAGTGAGAAGG + Intergenic
1024746504 7:52413084-52413106 AGGTGGTAGCAGCCATGTGAGGG + Intergenic
1031896443 7:127354512-127354534 ATATGCTACCATCTGTGTGAAGG + Intronic
1036944141 8:13078928-13078950 ATTTCATAGCAGCCTTTTGAGGG - Intergenic
1036973702 8:13384239-13384261 ACTTGCTAGCACCTTTGTGATGG - Intronic
1037443289 8:18939050-18939072 ATTTTCTAGCACCCCTGTAATGG - Intronic
1045312940 8:101019000-101019022 CTTGGCTATCAGCTGTGTGAGGG + Intergenic
1046564007 8:115875225-115875247 TTTTGCTAGAAGCCATTTGATGG + Intergenic
1047467442 8:125131302-125131324 GTTTGCTGGCAGCAGTGTTAAGG + Intronic
1048905036 8:139079493-139079515 TATTGCTAGCAGCTGTGTGATGG + Intergenic
1189746614 X:44174819-44174841 ATTTGCTAGCAGCCGTGTGAGGG - Intronic
1195536853 X:106018304-106018326 ATTTGCTAGCAGATTTGAGAAGG - Intergenic
1200694041 Y:6341207-6341229 GTTTGCTAGCAGCTGAGGGAAGG - Intergenic
1200908041 Y:8505616-8505638 GTTTGCTAGCAGCTGAGGGAAGG - Intergenic
1200952559 Y:8914412-8914434 GTTTGCTAGCAGCTGAGGGAAGG - Intergenic
1201041236 Y:9833512-9833534 GTTTGCTAGCAGCTGAGGGAAGG + Intergenic
1202108568 Y:21397109-21397131 GTTTGCTAGCAGCTGAGGGAAGG + Intergenic
1202112105 Y:21432353-21432375 GTTTGCTAGCAGCTGAGGGAAGG + Intergenic