ID: 1189750300

View in Genome Browser
Species Human (GRCh38)
Location X:44213815-44213837
Sequence CTAGTTCAGGCCATGATGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 6, 2: 13, 3: 22, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189750300_1189750304 -1 Left 1189750300 X:44213815-44213837 CCCCTCATCATGGCCTGAACTAG 0: 1
1: 6
2: 13
3: 22
4: 109
Right 1189750304 X:44213837-44213859 GTCCCTCAAGTTAGTCCCTCAGG 0: 1
1: 0
2: 0
3: 1
4: 79
1189750300_1189750305 0 Left 1189750300 X:44213815-44213837 CCCCTCATCATGGCCTGAACTAG 0: 1
1: 6
2: 13
3: 22
4: 109
Right 1189750305 X:44213838-44213860 TCCCTCAAGTTAGTCCCTCAGGG 0: 1
1: 0
2: 1
3: 5
4: 95
1189750300_1189750312 21 Left 1189750300 X:44213815-44213837 CCCCTCATCATGGCCTGAACTAG 0: 1
1: 6
2: 13
3: 22
4: 109
Right 1189750312 X:44213859-44213881 GGATACCCTTGCTGAGAGGAGGG 0: 1
1: 0
2: 10
3: 22
4: 158
1189750300_1189750310 17 Left 1189750300 X:44213815-44213837 CCCCTCATCATGGCCTGAACTAG 0: 1
1: 6
2: 13
3: 22
4: 109
Right 1189750310 X:44213855-44213877 TCAGGGATACCCTTGCTGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 145
1189750300_1189750311 20 Left 1189750300 X:44213815-44213837 CCCCTCATCATGGCCTGAACTAG 0: 1
1: 6
2: 13
3: 22
4: 109
Right 1189750311 X:44213858-44213880 GGGATACCCTTGCTGAGAGGAGG 0: 1
1: 0
2: 7
3: 23
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189750300 Original CRISPR CTAGTTCAGGCCATGATGAG GGG (reversed) Intronic
900594479 1:3474505-3474527 CCAGGTCAGGCCAGGTTGAGTGG - Intronic
900659677 1:3776284-3776306 CTTGTGAAGGCCAGGATGAGGGG + Intergenic
903006872 1:20304368-20304390 CGTGTTCAGGGCATGATGAGAGG + Intronic
908382497 1:63609866-63609888 CTAGGCCAGGCCATGATGTTTGG + Intronic
908816449 1:68040219-68040241 CTAGGGAAGGCCATGAAGAGAGG + Intergenic
909177768 1:72381735-72381757 CTCTTTCCGGCCATTATGAGAGG - Intergenic
909634366 1:77799388-77799410 CTAGTTTAAGCCATGATGTTTGG + Intronic
909801965 1:79821270-79821292 CAAGTTCAGGCCAGGCTCAGTGG + Intergenic
911333879 1:96557531-96557553 CTGTTTCATGCCATGATCAGAGG + Intergenic
912627185 1:111215132-111215154 CTGGTTCAGGCCATGATGGGGGG + Intronic
912810819 1:112793134-112793156 CCAATTCAGGCCATGATGGGAGG - Intergenic
913442997 1:118919025-118919047 CTAGTTTAGACCATAATGAGTGG + Intronic
914243949 1:145872364-145872386 GCAGTTCAGGCCACGATGAGCGG - Exonic
914690031 1:150017598-150017620 TTAGCTCAGGCAATGAGGAGAGG + Intergenic
917075502 1:171200409-171200431 CTGGTTCAGGCCTTCTTGAGAGG - Intronic
917374809 1:174339471-174339493 CTAATTCAGGCTATCATAAGTGG + Intronic
919978982 1:202630695-202630717 CTAGGTCAGGCTCTGAGGAGAGG - Intronic
922758837 1:228111702-228111724 CTGGTTCAGGCCATAAGAAGTGG - Intergenic
924924592 1:248666809-248666831 CTAGTTCAGGCCATGCGGGAAGG + Intergenic
1062824999 10:560788-560810 CTAGTCCAGGCCATGATCGGTGG + Intronic
1063417724 10:5888041-5888063 CTTGTGCAGGCCATCATCAGAGG + Exonic
1064939099 10:20712972-20712994 CTAGTTCAGGCCATGATGTGGGG - Intergenic
1066103943 10:32140699-32140721 CTAGTTCAGGCCATGATGGAAGG - Intergenic
1070636181 10:78129928-78129950 AGAGTTCAGGCCATGATTTGGGG + Intergenic
1072689428 10:97562021-97562043 CGAGTTCAGGCCATGATGGGAGG + Intronic
1074997565 10:118770893-118770915 CTAGTTCAGGCCATGATGGGAGG + Intergenic
1075300035 10:121314194-121314216 CTGGTCCAGGCCATGGTGAATGG + Intergenic
1075833131 10:125428160-125428182 CATGTCCAGGGCATGATGAGAGG - Intergenic
1077216275 11:1396441-1396463 CAGGGTGAGGCCATGATGAGAGG - Intronic
1079656257 11:22989310-22989332 CAAGTTCATCCCATGATGTGGGG + Intergenic
1081285692 11:41267017-41267039 CTAGCCCAGTCCATGATGAGTGG - Intronic
1083340631 11:61956324-61956346 CCAGGTCAGGCCAGGCTGAGGGG - Intronic
1083936257 11:65871619-65871641 CTAGCTCAGCCCAAGATGGGGGG + Intronic
1084001342 11:66296724-66296746 ATGGTTCAGGGCACGATGAGGGG + Intergenic
1085225322 11:74914809-74914831 CATGTTCAGTTCATGATGAGTGG - Intronic
1086664936 11:89468709-89468731 CTAGCTGAGGCAAAGATGAGAGG - Intronic
1094233133 12:28131388-28131410 CTAATTCAGGCCCAGAAGAGAGG + Intergenic
1096363173 12:51005910-51005932 CTAGTTCAGGCCATGATGGGAGG + Intronic
1097590352 12:61566993-61567015 CTAGCTCAGGTCATGATGGAAGG + Intergenic
1099802012 12:87469470-87469492 TTAGTTCAGGCCATGATGGGAGG + Intergenic
1102298785 12:111756663-111756685 CTGTTTCAGGCCAGGAGGAGGGG + Exonic
1115639623 14:35325549-35325571 CTACTCCAGGCCATGCTCAGTGG + Intergenic
1119005622 14:70924878-70924900 CTAGTTCAGGCCAGGTGCAGTGG - Intronic
1120234040 14:81870477-81870499 CTCCTTCTGGCCATGATGTGTGG + Intergenic
1120779892 14:88477749-88477771 CAAGTGCAGGGCATGAGGAGTGG + Intronic
1121082366 14:91118701-91118723 CTAGTCCAGGCCATGATGGGAGG - Intronic
1124456174 15:29844834-29844856 CTATTTGAAGCCATGAGGAGGGG + Intronic
1128220333 15:65964314-65964336 CAAGTTCAGGCCCTGATAAAGGG + Intronic
1131638278 15:94260813-94260835 TGAGTTCAGGCCATGATGGGAGG + Intronic
1134282103 16:12826165-12826187 CTAGTTCAGACCATGGTTGGGGG - Intergenic
1136425534 16:30167612-30167634 CTAGTTCAGGCCAGGAGCAGTGG + Intergenic
1136640991 16:31564933-31564955 CTTATTGAGGCCATGATGAGTGG - Intergenic
1138068251 16:53964386-53964408 CTAGTTGAGGCCAGGAGGAAGGG + Intronic
1138866864 16:60832308-60832330 TTAGTAAAGGCGATGATGAGAGG - Intergenic
1141171022 16:81691771-81691793 CTAGGTCAGACTATGATGACTGG + Exonic
1145012268 17:19376329-19376351 CTGGTTCAGGCCACGATGGGAGG + Intronic
1146592075 17:34136027-34136049 CTAGTTCAGGCTGTCATGACAGG + Intronic
1150953444 17:69827785-69827807 CCAGTGAAGGCCATGAAGAGAGG - Intergenic
1156115734 18:33785323-33785345 CTGGTACAGACCAGGATGAGGGG + Intergenic
1160417879 18:78724302-78724324 CTAGTTCAGGCCAGGAAGAGGGG - Intergenic
1162604144 19:11694299-11694321 CTTGTTCAGGCCATCATGGAAGG - Intergenic
1163435800 19:17294406-17294428 GTACTCCGGGCCATGATGAGCGG - Exonic
1164613620 19:29650945-29650967 CGGGTTCAGGCCATGATGAGAGG - Intergenic
1164656036 19:29922694-29922716 CAAGTTCAGGCCATGCACAGAGG - Intergenic
1165249781 19:34520628-34520650 CTAGTTCAGGTCATAATGGAAGG - Intergenic
1165257181 19:34585222-34585244 CTAGTTCAGGTCATAATGGAAGG - Intergenic
1166654879 19:44603757-44603779 CTGGTTCAGCCCATGACGGGTGG + Intergenic
926164910 2:10515655-10515677 CTAGATCAGGCCAGAAGGAGTGG + Intergenic
931415787 2:62079044-62079066 CTGGTTTAGGACATGATGGGAGG - Intronic
933228621 2:79779879-79779901 CTAGTTCAGGCCATGATGGGAGG + Intronic
936481190 2:112886328-112886350 CTAGTTCAGGTCATGATGGAAGG + Intergenic
937539255 2:122928018-122928040 GTACTTCAGGCAATGATGGGAGG + Intergenic
940398252 2:153218573-153218595 ATAGTTCAGGCCTGGAAGAGGGG - Intergenic
940704135 2:157082776-157082798 CTAGTGAAGGCCGTGATGGGAGG + Intergenic
947949715 2:234136565-234136587 CTAGTTCAGGCCATGATGGGAGG + Intergenic
1169749127 20:8973850-8973872 CTAATGCAGGCCATGATGGGAGG + Intergenic
1174749025 20:53093425-53093447 CTAGATCAGGCCATAGTGAAAGG - Intronic
1175375187 20:58519306-58519328 CTAGCACCGGCCATGGTGAGTGG - Intergenic
1178513108 21:33223589-33223611 TTTGTTCAGGCCATGATGAAAGG - Intergenic
1179016031 21:37595028-37595050 CTGGTTCAGGCCACGATGTGGGG + Intergenic
1183057440 22:35315589-35315611 CTAGATCAGGCCTGGAGGAGGGG - Intronic
1183963856 22:41429486-41429508 CTGAGTCAGGCAATGATGAGGGG + Intergenic
951773805 3:26286465-26286487 CTAGTTCAGGCCATGGTGGGAGG + Intergenic
951979131 3:28546461-28546483 CTAGTTCAGTCTCTGGTGAGGGG - Intergenic
953147606 3:40293149-40293171 CTGGTTCAGGCCATGATTCAGGG + Intergenic
953352433 3:42225586-42225608 GTATTTCTGGCAATGATGAGTGG - Exonic
953959229 3:47254701-47254723 CTAGTTAAGGCCATGGTGACTGG - Intronic
954941215 3:54374983-54375005 CATGTTCAGGCAATCATGAGTGG - Intronic
956759875 3:72431565-72431587 CTAGTTCTGGCCAGGCTCAGTGG + Intronic
961143759 3:124577138-124577160 GTGGTTCAGGCCATACTGAGAGG - Intronic
961470866 3:127111111-127111133 CTAGTTCAGGCCATGATGGGAGG + Intergenic
964235105 3:154516476-154516498 CAAGTGAAGGCCATGAAGAGAGG + Intergenic
966460408 3:180169463-180169485 CTGGTTCAGGCCAGGAAGATGGG + Intergenic
971219559 4:24692376-24692398 CTAGTTCATGCTATTATGAGTGG + Intergenic
973336559 4:48962544-48962566 CTAGTTCAGGTCATGATGGAAGG - Intergenic
979381959 4:120017454-120017476 TTAGTGCTAGCCATGATGAGTGG + Intergenic
982398846 4:154943454-154943476 GTAGTTCAGGCCATGGTGGGAGG + Intergenic
982771645 4:159401949-159401971 CTAGAGCAGGCTATAATGAGAGG + Intergenic
984601828 4:181736665-181736687 CTAGTTGAGGCCAGGATTATTGG - Intergenic
987730953 5:21772040-21772062 TTAGCTCAGGCTATGATGATGGG - Intronic
989422114 5:41252344-41252366 TTAGTTCAGGCCTTGTTGGGAGG + Intronic
991111238 5:62902036-62902058 CTAATTCATGCCAAGATGATTGG - Intergenic
992167409 5:74068362-74068384 CTAGGTGAGGCCATAATGACTGG - Intergenic
993010326 5:82475192-82475214 GTAGTTCAGGACAGCATGAGAGG + Intergenic
995893102 5:116979112-116979134 CTAGATAAGGCCATCTTGAGAGG + Intergenic
997723066 5:136096371-136096393 CTAGTTCAGGCCAGGTGCAGTGG + Intergenic
1003304661 6:4915468-4915490 CTAGTTCAGGCCATAATGTGGGG + Intronic
1005298964 6:24452429-24452451 CTAGTTTAGGCTCTGATGAAAGG - Intronic
1005730414 6:28691944-28691966 CGAGAACAGGCCATGATGAACGG + Intergenic
1007039915 6:38712140-38712162 CTAGTGCAGGCCATGATGGAAGG + Intergenic
1007579303 6:42946778-42946800 CTATTTCAGGCCCTGATAACAGG - Intergenic
1008459712 6:51753853-51753875 GCTGTTCAGGCCGTGATGAGTGG - Intronic
1008730260 6:54473536-54473558 CTGGTTCAGGCCATGAAAGGAGG + Intergenic
1011594596 6:89004346-89004368 CTAGTTCAGGCCAGGCACAGTGG + Intergenic
1013317748 6:108958129-108958151 TTAGATAAGGCCATGATGTGGGG + Intronic
1013447265 6:110242764-110242786 CTGGTGCAGGCCATGAGAAGAGG - Intronic
1014550763 6:122787599-122787621 CTGGTTCAGGCCATGAAAAAGGG - Intergenic
1018527746 6:164732700-164732722 ATATTTCAGTCCATGATGAACGG + Intergenic
1018595700 6:165478386-165478408 CTAGTTCAGGCAATGATGGGGGG + Intronic
1021544751 7:21800693-21800715 ATAGTTCAGGCAGTGAAGAGGGG - Intronic
1030353856 7:108521914-108521936 CTAGTTCAGGCCACGATGGAAGG + Intronic
1030498557 7:110330299-110330321 CCAATTAAGGCCTTGATGAGAGG - Intergenic
1031131738 7:117840800-117840822 CTATTTCAGTCCCTCATGAGAGG - Intronic
1033474972 7:141683351-141683373 CAAGTTCAGGCCAGGCTCAGTGG + Intronic
1033718100 7:144024165-144024187 GAGGTTCAGGCGATGATGAGAGG - Intergenic
1035430555 7:158817160-158817182 CTACTTCAGGCCACGATGAGGGG + Intronic
1036920077 8:12844055-12844077 CTAGTCCAGGCCAGGCTCAGTGG - Intergenic
1036930213 8:12949542-12949564 CTAGTTGAGGCCATCATAAGCGG - Intronic
1037429587 8:18795512-18795534 CAAGGTCAGGCCATGGTAAGAGG - Intronic
1038338042 8:26661344-26661366 CTTGTTGAGGCCATGAGGCGTGG + Intergenic
1038788813 8:30648445-30648467 CTAGTTCAGGCCACGGTCATTGG - Intronic
1038805743 8:30789689-30789711 GTCGTTCAGTCAATGATGAGAGG + Intronic
1040055673 8:43055469-43055491 CTTGTTCAGGCCATGATGGAAGG - Intronic
1045759765 8:105590512-105590534 TTACTTCAGGCCATGATTAATGG + Intronic
1048120594 8:131576814-131576836 CTAGGAAAGGCCATGAAGAGTGG - Intergenic
1049020848 8:139956829-139956851 CTCCTTCAGGCCGTGCTGAGGGG + Intronic
1050796862 9:9557207-9557229 CTAGTTCAGGCCATGATGGAAGG + Intronic
1051228495 9:14928311-14928333 CTAGATCAGTACATGAAGAGAGG + Intergenic
1052781755 9:32788785-32788807 CTAGTTCTGGTCCTGATGGGAGG - Intergenic
1055832695 9:80401024-80401046 CTAGTTCAGGCCATGACAGAAGG + Intergenic
1057911625 9:99024105-99024127 CTAGCCCTGGCCATGAGGAGTGG - Intronic
1059214423 9:112547474-112547496 CTAGTTCGGGCCATGATGCGGGG + Intronic
1061711295 9:132489789-132489811 CCAGCCCAGGCCAGGATGAGAGG - Intronic
1062307176 9:135914537-135914559 CTAGGGAAGGCCATGAAGAGAGG - Intergenic
1188114685 X:26228732-26228754 CTACTTCAGGCCGGGAAGAGTGG - Intergenic
1188634389 X:32410624-32410646 CAAGTCCATGCTATGATGAGAGG - Intronic
1189750300 X:44213815-44213837 CTAGTTCAGGCCATGATGAGGGG - Intronic
1193723638 X:85016521-85016543 CAGGTTCAGGCCAGCATGAGAGG - Intronic
1195585136 X:106556485-106556507 ATAGTTCAGTCAATGATCAGTGG + Intergenic
1196027434 X:111055731-111055753 TTGTTTCAGGCCATGAGGAGTGG - Intronic
1199820353 X:151439514-151439536 GCAGTTCAGGTCAGGATGAGAGG - Intergenic