ID: 1189755581

View in Genome Browser
Species Human (GRCh38)
Location X:44268231-44268253
Sequence AAAATCATTCTTGTGTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189755581_1189755583 15 Left 1189755581 X:44268231-44268253 CCTCCTTACACAAGAATGATTTT No data
Right 1189755583 X:44268269-44268291 GACTATCTTCAGCTTGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189755581 Original CRISPR AAAATCATTCTTGTGTAAGG AGG (reversed) Intronic