ID: 1189755896

View in Genome Browser
Species Human (GRCh38)
Location X:44271013-44271035
Sequence AGGTTCACACACTTGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189755896 Original CRISPR AGGTTCACACACTTGGGACA GGG (reversed) Intronic
900119515 1:1042488-1042510 GGGTCCTCACTCTTGGGACATGG + Intronic
900130900 1:1086828-1086850 AGGTTCACACTCATGGCTCACGG - Intronic
900161251 1:1225029-1225051 AGGGACACAGACTGGGGACACGG + Intronic
901212881 1:7536457-7536479 ATGGTCACAGACTTGGGACTAGG - Intronic
901452109 1:9342179-9342201 AGGCTCACTCACATGGAACATGG - Intronic
901493857 1:9610374-9610396 AGGTGCAGAGACTGGGGACAGGG - Intronic
901862685 1:12084963-12084985 AGGGTCACACAGTTGGGAAATGG + Intronic
902935993 1:19765030-19765052 AGGCACACACACTTGAGCCACGG - Intronic
903946941 1:26969927-26969949 AAGTTCACACAGTTAGGAAAAGG - Intergenic
904700406 1:32354545-32354567 AGGTTCAGACAACTGGGAGATGG - Intronic
904776553 1:32911877-32911899 GGGTACACACATTTGGAACATGG - Intergenic
905350554 1:37343394-37343416 AGGATCACACAGCCGGGACATGG - Intergenic
906244453 1:44263190-44263212 AGGATCAGACACTTGGAAAAGGG + Intronic
907865972 1:58399531-58399553 AGGTTCACACAGCTGGTAAATGG + Intronic
907873051 1:58460297-58460319 AGATGCACACACGTGGGACTGGG + Intronic
907928002 1:58972804-58972826 AAGTTCACACAGTTGGGAAGAGG + Intergenic
909922847 1:81403063-81403085 AGGTTCACTCAGTTGAGAGAAGG + Intronic
912384764 1:109265799-109265821 AGGGTCACAGACTCTGGACAAGG - Exonic
915033157 1:152901475-152901497 AGGTCCACAGACCTGGGACCTGG + Intergenic
915662594 1:157416411-157416433 AGGTTCACACAAACAGGACATGG + Intergenic
917265250 1:173214255-173214277 AAGGTCACACACTTAGTACATGG + Intergenic
919656748 1:200204107-200204129 AAGTTCATACACTTGGCAAATGG - Intergenic
921179048 1:212617217-212617239 ATGTTCACAGCCTTGGGACCAGG + Intronic
921714876 1:218407712-218407734 AGGGTCACACAGGTGGGAAATGG + Intronic
1063734710 10:8739996-8740018 AGCATCACACAATTGGGCCATGG - Intergenic
1064109869 10:12529310-12529332 AGGTTGGCACACTGGGGTCAGGG + Intronic
1066549015 10:36534699-36534721 AGGTTCACAAACTTAGGAAAGGG + Intergenic
1069118270 10:64535567-64535589 AGGTACAGAAACTTAGGACAGGG - Intergenic
1069837244 10:71317275-71317297 AGCTTCACAGACATGGGTCATGG + Intergenic
1071479770 10:86056458-86056480 AGATTGGCACCCTTGGGACACGG - Intronic
1073481412 10:103788292-103788314 AGGTTCACACAGCTGGTAAAGGG + Intronic
1074189471 10:111123488-111123510 AGGGTCACACAGTTGGTACGTGG + Intergenic
1075687815 10:124376399-124376421 AGGTTCACCCACCTGGGTCATGG - Intergenic
1076961998 10:133770736-133770758 AGGCTCAAAGTCTTGGGACAGGG + Intergenic
1077469314 11:2749411-2749433 AGGGTCACACAGTTGGCACCAGG - Intronic
1078065212 11:8074237-8074259 AGGTTCAAACACCTGGAAGAAGG + Intronic
1079363895 11:19792475-19792497 AGGTGCATACAGTTAGGACACGG - Intronic
1080610248 11:33897926-33897948 AGGTACGCACACCTGGAACATGG - Intergenic
1081060550 11:38469926-38469948 AGATTCAGACACATGGGAGAAGG + Intergenic
1083550962 11:63589955-63589977 AGGATGTCACAGTTGGGACAAGG - Intronic
1086402208 11:86470043-86470065 TGGTTCACACACTGGGGAGAAGG - Intronic
1089415197 11:118283043-118283065 AGGTTAACACCCTTAGCACAGGG - Intergenic
1093959431 12:25256075-25256097 GGGTTCACACACCTGAGATACGG - Intergenic
1096080672 12:48830365-48830387 AGGTCCTCACTCTTGGGATATGG - Exonic
1101679407 12:106950431-106950453 GGGTACATACACTTGGGAAATGG - Intergenic
1104513051 12:129399058-129399080 AGGAGCACACACATGGGACAAGG + Intronic
1107015425 13:35705092-35705114 AGGTGCACACACTTGGGCTGGGG + Intergenic
1113809053 13:113126556-113126578 TGGTTCACAGACTTGCCACAAGG - Intronic
1113933323 13:113980158-113980180 AGGTGCACACACGTGGGAGGAGG - Intronic
1113933332 13:113980201-113980223 AGGTGCACACACATGGGAGGAGG - Intronic
1113933353 13:113980325-113980347 AGGTGCACACATGTGGGAGAAGG - Intronic
1117663037 14:58028354-58028376 AGCTTCACCCACCTGGAACAGGG + Intronic
1118323999 14:64769325-64769347 AGGTGCACACACTTTGGAGCTGG - Intronic
1119362707 14:74064552-74064574 AGGGTCACACACTCAGGAAATGG + Intronic
1123223821 14:106881192-106881214 AGGGTCAAAGTCTTGGGACAGGG + Intergenic
1126551339 15:49933488-49933510 AGGTCCTCACACTTGTGAGATGG - Intronic
1128241998 15:66107584-66107606 CTCTTCACACACATGGGACATGG + Intronic
1128308584 15:66616291-66616313 AGGACCACACAGTTGGCACAAGG - Intronic
1128751201 15:70151004-70151026 AGGTTCACAACCTTTGGATACGG - Intergenic
1129850091 15:78788754-78788776 AAGTGCACAGCCTTGGGACAAGG - Intronic
1130252174 15:82306821-82306843 AAGTGCACAGCCTTGGGACAAGG + Intergenic
1131811855 15:96181051-96181073 AAGATCACACAACTGGGACATGG + Intergenic
1132897115 16:2234353-2234375 CGCTTGCCACACTTGGGACAAGG - Exonic
1135051280 16:19195032-19195054 AAGTTCACACAGCTGGGAAATGG - Intronic
1135109544 16:19680118-19680140 AAGGTCACACAGTTGGTACATGG - Intronic
1137682747 16:50364988-50365010 ACGTCAACACACTTGGGAGACGG + Intronic
1138146728 16:54619308-54619330 TGGTTCACAGCCTGGGGACAGGG + Intergenic
1138677854 16:58665085-58665107 AGGATCAGACACAGGGGACACGG + Intergenic
1138854550 16:60673029-60673051 ATGTTTTCACACTTGTGACATGG + Intergenic
1138934774 16:61705722-61705744 AGGTTCACAAAATTGGGTTAAGG + Intronic
1140317158 16:73909677-73909699 ACGTGCACACACTTTGGAAAGGG - Intergenic
1140922167 16:79549593-79549615 AGGTTTCCACACTGAGGACATGG - Intergenic
1141881708 16:86864550-86864572 AGGATCAAAAACCTGGGACAGGG - Intergenic
1142134272 16:88444474-88444496 AGGTTCACGCAGTGGGGAGAGGG + Intergenic
1147626805 17:41905684-41905706 TGGCTCTCACACTTGGGGCAGGG + Intronic
1148916617 17:50986032-50986054 AGGTTCACACACTTAGTCCTTGG + Intronic
1151933484 17:77247529-77247551 AGGACCACACACTTGGAAGACGG - Intergenic
1152964291 18:100094-100116 AGGGTCAAAGTCTTGGGACAGGG - Intergenic
1155131075 18:22934824-22934846 AAGGTCACACAGCTGGGACATGG - Intronic
1156558348 18:38092805-38092827 ATGTTCAAAAACTTGGGACTTGG + Intergenic
1160654600 19:258059-258081 AGGGTCAAAGTCTTGGGACAGGG - Intergenic
1163009095 19:14413580-14413602 AGGTTCAAAGGCTTGGGGCAGGG - Intronic
1165059001 19:33195703-33195725 AGGCTCACACAGCTGGGGCAAGG - Intronic
1165878244 19:39024902-39024924 AGGTTCACACCCTTAGGGCTGGG + Exonic
1168727146 19:58591439-58591461 AGGCTCAAAGTCTTGGGACAGGG + Intergenic
925361738 2:3284787-3284809 AGGAGCACACAGTTGGGAAAGGG + Intronic
926668865 2:15555783-15555805 AGGTTCTCACACAGAGGACAGGG + Intronic
927179072 2:20431227-20431249 ACATTCACTCACTTAGGACATGG + Intergenic
928222693 2:29418001-29418023 AGCTTCACACCCCTGGGGCATGG + Intronic
929592107 2:43154118-43154140 AGGCTCACACACTAGGGATTGGG + Intergenic
932849670 2:75172292-75172314 AGGTTCAAAAACTTGGGATGGGG - Intronic
933947790 2:87301743-87301765 ATTTTCACACACTTTGAACATGG - Intergenic
935114777 2:100125939-100125961 CTGTGCACACACTTGGGACCAGG + Intronic
935240283 2:101171921-101171943 AGGTTCTCATAGTGGGGACAAGG - Intronic
936332410 2:111559830-111559852 ATTTTCACACACTTTGAACATGG + Intergenic
936571407 2:113619756-113619778 AGGCTCAAAGTCTTGGGACAGGG - Intergenic
941736827 2:168986786-168986808 AGGTTCACAGCCATGAGACATGG + Intronic
942051932 2:172148008-172148030 AGGTTCACACACTCAGGTCCTGG + Intergenic
943172697 2:184424107-184424129 AGGTTCTCACACGTGGGCTAGGG - Intergenic
945933897 2:215883688-215883710 AGCTTCAGACACCTGGGACACGG + Intergenic
947565789 2:231192160-231192182 CGGCTCACATCCTTGGGACAGGG + Intergenic
1168927472 20:1594674-1594696 AGGGTCACACACTTGGGAGCTGG - Intronic
1171424782 20:25042645-25042667 AGGGTCACCCACTAGGGACATGG + Intronic
1173404400 20:42752412-42752434 AAGGTCACAGAGTTGGGACAAGG + Intronic
1174389961 20:50212981-50213003 ATGTTCACACACTTGGTGCCCGG + Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1178314719 21:31558725-31558747 GTGTTCACACACTTGGGAGGTGG - Intronic
1180262587 21:46683241-46683263 AGGCTCAAAGTCTTGGGACAGGG + Intergenic
1182153658 22:28049088-28049110 AGGATCAGAGACTTGAGACAGGG - Intronic
1182275792 22:29187929-29187951 CGGTTCACCCAGTTAGGACAGGG + Intergenic
1185428784 22:50791118-50791140 AGGCTCAAAGTCTTGGGACAGGG + Intergenic
949628241 3:5892271-5892293 AAGTTCACACACCTAGTACAAGG - Intergenic
951729915 3:25798948-25798970 GTGTTCACACAATTAGGACAGGG - Intergenic
954676687 3:52319764-52319786 AGGTGCACAGAGTTGGGGCAGGG + Intronic
954879598 3:53824311-53824333 AGGTTCATACACAGGGCACAGGG - Intronic
955220499 3:57019348-57019370 GGGTGCACACACTTGGGTCCAGG - Intronic
957751628 3:84426221-84426243 ATGTGCAGACACTTGGGAGACGG + Intergenic
958999105 3:100940732-100940754 AGCTACAAACACTTTGGACATGG + Intronic
962027973 3:131568695-131568717 AGCTCCACACACTGGGGACTTGG - Intronic
962779529 3:138699018-138699040 ATTTTCACACAGTTGAGACAAGG + Exonic
968374060 4:23151-23173 AGGGTCAAAGTCTTGGGACAGGG - Intergenic
968747139 4:2365876-2365898 AGGTTCAGACACTGGGGACTGGG + Intronic
972459925 4:39292222-39292244 ACATTCACACACTTGAGATAGGG - Intronic
976588050 4:86820657-86820679 ATGTTCAGGCACATGGGACATGG - Intergenic
980163640 4:129198088-129198110 AGGTTCCAAGGCTTGGGACATGG - Intergenic
982223813 4:153147348-153147370 AGGTTCACACACTTGTGAGTTGG - Intergenic
984896629 4:184547317-184547339 AGGTGCACACAGCTGGGACCTGG - Intergenic
985053174 4:186013040-186013062 AGGTTCACACTCTGGGGACATGG + Intergenic
985460670 4:190103112-190103134 AGGGTCAAAGTCTTGGGACAGGG + Intergenic
985465230 4:190188215-190188237 AGGCTCAAAGTCTTGGGACAGGG + Intergenic
986107338 5:4672416-4672438 AAGTTCAGAGACTTGGGACCAGG - Intergenic
987065097 5:14281950-14281972 AGGTTGACACAAGCGGGACAAGG + Intronic
988615201 5:32768570-32768592 AGGGTCACACAGCTGGCACACGG - Intronic
992090768 5:73314159-73314181 ACATCCACACAGTTGGGACAAGG + Intergenic
992214351 5:74510734-74510756 AGGTTAACACACTTAGGGTAAGG + Intergenic
994795971 5:104300036-104300058 AGGGGCACATACTTGGGCCATGG + Intergenic
995634862 5:114176203-114176225 TGGTTGCCACACTTGGGAAAGGG - Intergenic
999512459 5:152266953-152266975 AGTTTCACACACTGTGGCCATGG + Intergenic
1001182150 5:169530496-169530518 TGCTTCACACACTTGGAAGAGGG + Intergenic
1001688014 5:173610105-173610127 ATATTCAAACACTTGGGACAGGG + Intronic
1004139699 6:13005891-13005913 AAGTTCTCACACTTGGAAAAAGG + Intronic
1004987151 6:21095391-21095413 ATGTTCACACAAGTGGGAAAAGG - Intronic
1005026183 6:21465195-21465217 AGCTTCATACAGTTGGGTCAAGG - Intergenic
1012112842 6:95259310-95259332 GGTTACACAGACTTGGGACATGG + Intergenic
1013212448 6:107999204-107999226 AGGTTAACACTCTTAGGAGAGGG - Intergenic
1014702069 6:124701994-124702016 AGATTCAAAGACTTTGGACATGG + Intronic
1016676708 6:146778709-146778731 AATTTCATACACTTGTGACAAGG + Intronic
1016725626 6:147362890-147362912 TTGTTCACACACTTTGGACAAGG + Intronic
1017817588 6:158026936-158026958 AAGTTATCACACTGGGGACAGGG - Intronic
1019196119 6:170284011-170284033 AGGTCCACACACTTGGCACCTGG + Exonic
1019250256 6:170739752-170739774 AGGGTCAAAGTCTTGGGACAGGG + Intergenic
1019611419 7:1938703-1938725 AGGTGCACACACATGGGCCAGGG + Intronic
1022522015 7:31014503-31014525 AGGTTCACACACCCTGGGCAGGG - Intergenic
1024421807 7:49176449-49176471 AGGTTCACACACCTGACAGATGG - Intergenic
1024706378 7:51964851-51964873 AAGTTCACACACTTGAGAAGGGG - Intergenic
1028672404 7:93418177-93418199 AGGTTAGCACACTTAGGATAGGG - Intergenic
1030221586 7:107104421-107104443 ACATTCTCACCCTTGGGACAAGG - Intronic
1031680554 7:124668236-124668258 AAGTTCACACAGCTGGTACATGG - Intergenic
1031681688 7:124682402-124682424 ATGATCTCACACTTGGGAGAAGG - Intergenic
1032521448 7:132548663-132548685 TGGTTCAAACACTTCTGACAGGG - Intronic
1035514302 8:219457-219479 AGGGTCAAAGTCTTGGGACAGGG - Intergenic
1036392696 8:8338203-8338225 AGGTTAAAACACATGGTACATGG - Intronic
1037989579 8:23311305-23311327 AGGTGCACACAGATGGCACATGG + Intronic
1038301510 8:26354655-26354677 AGGTACACACAGTGGGCACATGG - Intronic
1040728659 8:50414826-50414848 AGGTTCACAAAGTTGGCAAATGG - Intronic
1047632455 8:126723064-126723086 ATGTTCATACACATGGGTCATGG - Intergenic
1047776284 8:128073415-128073437 AGAATCACACACCTGGGAGATGG + Intergenic
1048660514 8:136595277-136595299 AAGTTCACACAGTTTGAACAGGG - Intergenic
1049654300 8:143791084-143791106 AGGTTAAAAGACTTGGGGCAAGG + Exonic
1051426856 9:16940747-16940769 AGGTTAACACTCTTAGGATAAGG - Intergenic
1053315501 9:37047640-37047662 AGGATCACACAGTTAGGAGATGG + Intergenic
1053320391 9:37093161-37093183 AGGATCACACAGTTAGGAGATGG + Intergenic
1055604305 9:77951901-77951923 AGGTCCACAGACCTAGGACATGG + Intronic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1057024870 9:91727149-91727171 AGTTTCACTCACCTTGGACAAGG - Intronic
1059695944 9:116730611-116730633 AGATTCAGACACCAGGGACAAGG + Intronic
1060520455 9:124291198-124291220 AGGTGCACACAACTGGGACGTGG + Intronic
1061056208 9:128224321-128224343 ATGTCCACACACTTGAGACACGG - Exonic
1061944794 9:133902557-133902579 AGGTTCCCACATTTGGTGCAGGG + Intronic
1187563574 X:20426086-20426108 AGCTTCAAACATTTGGGAGATGG - Intergenic
1188975729 X:36673028-36673050 AGGTTAATACACTTGGAACAAGG - Intergenic
1189373980 X:40452001-40452023 GGGTTCACACACTTAGGATGGGG + Intergenic
1189755896 X:44271013-44271035 AGGTTCACACACTTGGGACAGGG - Intronic
1190510955 X:51173879-51173901 TGGGTCACAGACTTGGGTCATGG + Intergenic
1191855928 X:65626924-65626946 AGGGTCCCACACTGGGAACATGG + Intronic
1192093961 X:68190389-68190411 AGTTTCATACATTTGGGGCAGGG + Intronic
1193468801 X:81875694-81875716 GGGTTCACATGCTTGGGGCAGGG - Intergenic
1196440317 X:115714006-115714028 TGGTTCACACAATTAGGACATGG - Intergenic
1196466477 X:115976740-115976762 TGGTTCACACAATTAGTACATGG + Intergenic
1199928910 X:152498012-152498034 AGGTTCATAGAATTAGGACATGG + Intergenic