ID: 1189765948

View in Genome Browser
Species Human (GRCh38)
Location X:44372333-44372355
Sequence TCTTACCTAAAGTAAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189765944_1189765948 16 Left 1189765944 X:44372294-44372316 CCTGGTATTATGCAATGCGTGAT No data
Right 1189765948 X:44372333-44372355 TCTTACCTAAAGTAAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189765948 Original CRISPR TCTTACCTAAAGTAAGTGGA GGG Intergenic
No off target data available for this crispr