ID: 1189766617

View in Genome Browser
Species Human (GRCh38)
Location X:44378635-44378657
Sequence GTTCCCACCATTTCTAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189766617_1189766621 0 Left 1189766617 X:44378635-44378657 CCAATTCTAGAAATGGTGGGAAC No data
Right 1189766621 X:44378658-44378680 CCTCCTGAAATTCAAGTTCTGGG No data
1189766617_1189766619 -1 Left 1189766617 X:44378635-44378657 CCAATTCTAGAAATGGTGGGAAC No data
Right 1189766619 X:44378657-44378679 CCCTCCTGAAATTCAAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189766617 Original CRISPR GTTCCCACCATTTCTAGAAT TGG (reversed) Intergenic
No off target data available for this crispr