ID: 1189768349

View in Genome Browser
Species Human (GRCh38)
Location X:44395195-44395217
Sequence TTCAGCCCACTACACATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189768349_1189768353 10 Left 1189768349 X:44395195-44395217 CCAAAAATGTGTAGTGGGCTGAA No data
Right 1189768353 X:44395228-44395250 ATGGATCCTGGGAGCCTGCATGG No data
1189768349_1189768352 -1 Left 1189768349 X:44395195-44395217 CCAAAAATGTGTAGTGGGCTGAA No data
Right 1189768352 X:44395217-44395239 ACAGAAAGTGAATGGATCCTGGG No data
1189768349_1189768350 -9 Left 1189768349 X:44395195-44395217 CCAAAAATGTGTAGTGGGCTGAA No data
Right 1189768350 X:44395209-44395231 TGGGCTGAACAGAAAGTGAATGG No data
1189768349_1189768351 -2 Left 1189768349 X:44395195-44395217 CCAAAAATGTGTAGTGGGCTGAA No data
Right 1189768351 X:44395216-44395238 AACAGAAAGTGAATGGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189768349 Original CRISPR TTCAGCCCACTACACATTTT TGG (reversed) Intergenic
No off target data available for this crispr