ID: 1189772626

View in Genome Browser
Species Human (GRCh38)
Location X:44441641-44441663
Sequence AGGGTCTCCCAGCACCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189772626_1189772632 23 Left 1189772626 X:44441641-44441663 CCTTGATGGTGCTGGGAGACCCT No data
Right 1189772632 X:44441687-44441709 TCATTAAGGATTTCATTCAACGG No data
1189772626_1189772629 9 Left 1189772626 X:44441641-44441663 CCTTGATGGTGCTGGGAGACCCT No data
Right 1189772629 X:44441673-44441695 TCCTGATCAACACCTCATTAAGG No data
1189772626_1189772633 27 Left 1189772626 X:44441641-44441663 CCTTGATGGTGCTGGGAGACCCT No data
Right 1189772633 X:44441691-44441713 TAAGGATTTCATTCAACGGCCGG No data
1189772626_1189772634 28 Left 1189772626 X:44441641-44441663 CCTTGATGGTGCTGGGAGACCCT No data
Right 1189772634 X:44441692-44441714 AAGGATTTCATTCAACGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189772626 Original CRISPR AGGGTCTCCCAGCACCATCA AGG (reversed) Intergenic
No off target data available for this crispr