ID: 1189772944

View in Genome Browser
Species Human (GRCh38)
Location X:44444323-44444345
Sequence AGGGTCTCCCAGCACCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189772944_1189772952 28 Left 1189772944 X:44444323-44444345 CCTTGATGGTGCTGGGAGACCCT No data
Right 1189772952 X:44444374-44444396 AAGGATTTCATTCAACGGCCGGG No data
1189772944_1189772951 27 Left 1189772944 X:44444323-44444345 CCTTGATGGTGCTGGGAGACCCT No data
Right 1189772951 X:44444373-44444395 TAAGGATTTCATTCAACGGCCGG No data
1189772944_1189772950 23 Left 1189772944 X:44444323-44444345 CCTTGATGGTGCTGGGAGACCCT No data
Right 1189772950 X:44444369-44444391 TCATTAAGGATTTCATTCAACGG No data
1189772944_1189772947 9 Left 1189772944 X:44444323-44444345 CCTTGATGGTGCTGGGAGACCCT No data
Right 1189772947 X:44444355-44444377 TCCTGATCAACACCTCATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189772944 Original CRISPR AGGGTCTCCCAGCACCATCA AGG (reversed) Intergenic
No off target data available for this crispr