ID: 1189786911

View in Genome Browser
Species Human (GRCh38)
Location X:44567156-44567178
Sequence CTACATACGGGGAAGGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189786904_1189786911 -2 Left 1189786904 X:44567135-44567157 CCTATTAATAAAGGCAGAAGTCT No data
Right 1189786911 X:44567156-44567178 CTACATACGGGGAAGGGTGGAGG No data
1189786901_1189786911 21 Left 1189786901 X:44567112-44567134 CCTGAGTTACTACCAGCAAGGGA No data
Right 1189786911 X:44567156-44567178 CTACATACGGGGAAGGGTGGAGG No data
1189786902_1189786911 9 Left 1189786902 X:44567124-44567146 CCAGCAAGGGACCTATTAATAAA No data
Right 1189786911 X:44567156-44567178 CTACATACGGGGAAGGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189786911 Original CRISPR CTACATACGGGGAAGGGTGG AGG Intergenic
No off target data available for this crispr