ID: 1189794406

View in Genome Browser
Species Human (GRCh38)
Location X:44633739-44633761
Sequence GGTGCTCCGCTGCCACCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189794404_1189794406 -8 Left 1189794404 X:44633724-44633746 CCAACTCCTTGGACTGGTGCTCC 0: 1
1: 1
2: 0
3: 12
4: 141
Right 1189794406 X:44633739-44633761 GGTGCTCCGCTGCCACCTCAAGG 0: 1
1: 0
2: 1
3: 9
4: 151
1189794400_1189794406 5 Left 1189794400 X:44633711-44633733 CCCTAGAGAGCGGCCAACTCCTT No data
Right 1189794406 X:44633739-44633761 GGTGCTCCGCTGCCACCTCAAGG 0: 1
1: 0
2: 1
3: 9
4: 151
1189794401_1189794406 4 Left 1189794401 X:44633712-44633734 CCTAGAGAGCGGCCAACTCCTTG No data
Right 1189794406 X:44633739-44633761 GGTGCTCCGCTGCCACCTCAAGG 0: 1
1: 0
2: 1
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189794406 Original CRISPR GGTGCTCCGCTGCCACCTCA AGG Intergenic
900099560 1:955778-955800 CGTGCCCCGCTGCCTTCTCAGGG + Intronic
900122549 1:1054976-1054998 GGGGCTCTGGTGCCAGCTCATGG - Exonic
900208532 1:1441755-1441777 GGTGCCCCGCTGCCACCTGCAGG - Exonic
900339342 1:2180724-2180746 GCTGCTGTGCTGCCACCCCAGGG + Intronic
900399311 1:2466523-2466545 TCTGAGCCGCTGCCACCTCAAGG - Intronic
901195095 1:7435981-7436003 GGTTCTCTGCTGCAAGCTCAGGG - Intronic
902330703 1:15729961-15729983 GCTGCTGCTCTGCCATCTCAGGG - Intronic
902804911 1:18855028-18855050 GGTGCTCTGCCCCCACCCCAGGG + Intronic
902920878 1:19665395-19665417 GGGGCTCTGCTCCCACCCCAGGG + Exonic
905092954 1:35444227-35444249 TGAGCATCGCTGCCACCTCATGG + Exonic
908595813 1:65687847-65687869 TGTGCTCTGCTGCCACCTGCTGG + Intergenic
912752683 1:112298753-112298775 GGTGCTCTGCTGCCCCCTGGGGG - Intergenic
913349686 1:117843322-117843344 AGTGCTCAGCTCCCACCTCCTGG - Intergenic
915312937 1:155013561-155013583 GGTGCTCTGCACCCACCTCCTGG + Intronic
916371555 1:164101966-164101988 GGTGCTCCAGTGCCACCCCAGGG - Intergenic
918180826 1:182085087-182085109 GGGGCAACGCTGCCACCTCCTGG - Intergenic
920277839 1:204821031-204821053 GGTTCTCAGCTGCGACCTCCTGG + Intergenic
921757889 1:218880758-218880780 GGTGCTCCTCTAAAACCTCAGGG + Intergenic
1067061270 10:43079049-43079071 GGTGCTCCCCAACCACCCCAAGG + Intronic
1070767761 10:79066571-79066593 GATGCTCAGCTGCCACCTACAGG + Intergenic
1073266177 10:102229932-102229954 GGTGCTGCGGCGCCACCTCGTGG - Intergenic
1074775362 10:116764078-116764100 GGACCTCCCCTGCCTCCTCATGG + Intergenic
1075575895 10:123577271-123577293 AGTTTTCAGCTGCCACCTCAGGG - Intergenic
1076195283 10:128513251-128513273 GGTGCTCTCCTACCACCTCTCGG - Intergenic
1076690852 10:132223278-132223300 GGGCCTCGGCTGCCACCTCCTGG - Intronic
1076868518 10:133181369-133181391 GCTGCTCTGCTGCCAACTCCTGG - Intronic
1077154280 11:1084460-1084482 GGTGCTCTGAGTCCACCTCACGG - Intergenic
1080247564 11:30196781-30196803 TGTGCACCACTGCCACCTCGTGG + Intergenic
1083726853 11:64633017-64633039 GGTGCCCACCTCCCACCTCATGG + Intronic
1084837601 11:71813928-71813950 CGTCCTGTGCTGCCACCTCATGG - Intergenic
1092401099 12:8180141-8180163 CGTCCTGTGCTGCCACCTCATGG + Intronic
1095976389 12:47943278-47943300 GGTGCCCCCCTGCTCCCTCATGG - Intergenic
1098385003 12:69909297-69909319 GGGGCTCTACTGCCACCTCAGGG + Intronic
1102770346 12:115470701-115470723 GATGATAAGCTGCCACCTCACGG - Intergenic
1102885905 12:116521609-116521631 GGTGACTCGCTGCCACCCCAGGG + Intergenic
1106227722 13:27797393-27797415 GGTGCGCCGCAGCCGCCTCCAGG - Intergenic
1106248871 13:27969134-27969156 GGTGCTCCGCTGGCTCCTCGCGG + Exonic
1112277324 13:98033469-98033491 GCTCCTCTGCTGCCCCCTCAAGG - Intergenic
1112901489 13:104363033-104363055 GGTGCTCCACCACCACATCATGG + Intergenic
1117254388 14:53963470-53963492 CGTGCTCCGCTGATACCCCAGGG + Intergenic
1121336328 14:93079578-93079600 AGTTTTCCGCTGCCACCTCCTGG - Intronic
1121485266 14:94309903-94309925 GGTGCTCGACTGCAACATCATGG + Exonic
1124136773 15:27042333-27042355 GGGCCTCCCCTGCCACCTGAGGG + Intronic
1126109836 15:45168683-45168705 AGTGCTCAGCTGCCTCCTCCTGG + Intronic
1129117783 15:73374879-73374901 TCTGCTCAGCTGGCACCTCAGGG - Intergenic
1131120975 15:89823368-89823390 CCTGCCCTGCTGCCACCTCAGGG - Intergenic
1132879147 16:2153688-2153710 GGTGCTCTGCTGCCCCCTCCTGG + Exonic
1133128522 16:3662353-3662375 GGTGCCCCGCTGCTGCCTCCAGG + Exonic
1133282100 16:4672466-4672488 GGTGCTCCGCTCCCGCCACGTGG - Intronic
1134672241 16:16064427-16064449 GGTGCTCAGTTACCACCTGAGGG + Intronic
1139150964 16:64381411-64381433 GGGGCTCAGCTGCCAGCTCCAGG + Intergenic
1139752986 16:69120358-69120380 CGTGCTCCGCTGCCACCTCGAGG - Exonic
1141569422 16:84925319-84925341 GGTGCTCTGCTGCCCCCTGGTGG - Intergenic
1141890170 16:86921042-86921064 TGTACTCCCCTTCCACCTCATGG + Intergenic
1142644131 17:1301111-1301133 GGGGCTCCGTGGCCAACTCAAGG + Intergenic
1143308418 17:5968368-5968390 GGTGCCCCTCCTCCACCTCAAGG + Intronic
1144578474 17:16444521-16444543 GGGGCTGAGCTGCCACCCCAGGG - Intronic
1147190230 17:38734142-38734164 GGTGGTCCGCTGACCTCTCAAGG + Exonic
1149577783 17:57726476-57726498 AGTGCTCCACAGCCTCCTCATGG - Intergenic
1151206508 17:72512115-72512137 GGTGCTCCCAAGCCACCTCTGGG - Intergenic
1152577345 17:81148641-81148663 GGTGTGCCGCAGGCACCTCAGGG - Intronic
1157877332 18:51286058-51286080 GTTACTCCGCTGCCATCTCTGGG - Intergenic
1157975443 18:52322158-52322180 GGTGCTCTGATGTCACCTCATGG + Intergenic
1165663845 19:37608698-37608720 GGTGCACCTGTGCCACCTGATGG + Intronic
1165815143 19:38637222-38637244 GGTGCTCAGCCTCCACCACAGGG - Intergenic
1165943102 19:39425056-39425078 GGTCCTCTGCTCCCACGTCACGG + Exonic
1166667399 19:44689345-44689367 GGTGCTCTGCTGCCCCCTGCTGG - Intergenic
1167435443 19:49476063-49476085 GGATCTCTGCTGCCACCTCTGGG + Intronic
1167503268 19:49858862-49858884 GCTCCTCCTCTGCCACATCAGGG + Intronic
1167527614 19:49994777-49994799 GTTGCTCAGCTGCCGCGTCAGGG - Intronic
926883988 2:17579935-17579957 GGTGCTGAGATGTCACCTCAGGG - Intronic
929579168 2:43070902-43070924 GGTGCCCCATTTCCACCTCATGG + Intergenic
930011714 2:46942333-46942355 TGTTCCCCGCTGCCACATCAGGG - Intronic
930261789 2:49155219-49155241 AGTGCTGGGCTGTCACCTCAGGG - Intergenic
935765744 2:106366274-106366296 CGTGCTCTGCTGCAGCCTCAGGG - Intergenic
938298215 2:130191793-130191815 GGTTCTCCCCTGCCACCCCTAGG - Exonic
938458553 2:131482864-131482886 GGTTCTCCCCTGCCACCCCCGGG + Exonic
944905733 2:204260279-204260301 TGTGCTCGTCTGCCACCTCGTGG - Intergenic
948520404 2:238533052-238533074 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
948520459 2:238533471-238533493 GGTGCAGTGCTTCCACCTCAGGG + Intergenic
948520987 2:238537701-238537723 GGTGCAGTGCTGCCACCTCAGGG + Intergenic
948521075 2:238538307-238538329 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
948521250 2:238539638-238539660 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
948521374 2:238540638-238540660 GGTGCAGTGCTTCCACCTCAGGG + Intergenic
948521508 2:238541636-238541658 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
948521627 2:238542581-238542603 GGTGCAGTGCTACCACCTCAGGG + Intergenic
948521762 2:238543659-238543681 GGTGAAGTGCTGCCACCTCAGGG + Intergenic
948522143 2:238546602-238546624 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
948522632 2:238550119-238550141 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
1170566653 20:17611608-17611630 GGTGCCACGCTGCCGCCTCTGGG - Intergenic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1172018759 20:31897725-31897747 GGTGCCCTGCTGCAAACTCAGGG + Intronic
1174486204 20:50862772-50862794 GGTGCTCAGATGCCTCCTCCAGG - Intronic
1175874161 20:62221570-62221592 ATTCCTCTGCTGCCACCTCAGGG + Intergenic
1176030551 20:63009229-63009251 GGTGCGACGCTGCCACCTGCTGG + Intergenic
1178796348 21:35747888-35747910 GGGGCTCCACTGCCTCCCCAGGG + Intronic
1180129918 21:45820732-45820754 GGACCTCTGCTGCCACCTCGTGG + Intronic
1181518451 22:23431843-23431865 GGGGTTCCGCTGCGAGCTCAGGG + Intergenic
1182558343 22:31140937-31140959 GGTGCTCCCCTGCCAAGTCCTGG + Intergenic
1183076533 22:35430987-35431009 GGTGCTCTGGCGCCCCCTCATGG - Intergenic
1184175297 22:42785590-42785612 GGTGCCCCTCTGCCAGCTGAGGG + Intergenic
951957026 3:28268635-28268657 AGTTCTCCGATGCCACCTAAGGG + Intronic
952655571 3:35781145-35781167 GGAGCTCCTCTGCAGCCTCAAGG + Intronic
953982156 3:47418320-47418342 TGTGCTGCGCGGCCACCTCATGG - Exonic
954671300 3:52292676-52292698 GAAGCTCAGCTGCCAGCTCATGG - Exonic
958268555 3:91469457-91469479 GGTGCTCCACTGCCTCCTGCTGG + Intergenic
961169303 3:124785037-124785059 GCTGCTTCCCTGCCGCCTCATGG - Intronic
961316099 3:126036600-126036622 GGTGCTTCGCTGCCTCTTCTTGG + Intronic
961402092 3:126654810-126654832 GGAGCTGCGCCGCCACCTCGTGG - Intronic
967197715 3:187043117-187043139 GGCCCTGCGCTGCCACCTCCGGG + Exonic
968548119 4:1208788-1208810 GGTGCTGGGCTTCCCCCTCATGG - Exonic
968682475 4:1930619-1930641 GGTGCTCAGCTACCACCTGTGGG - Exonic
969419289 4:7082203-7082225 GGTGTGCCGGCGCCACCTCATGG + Intergenic
969499967 4:7546654-7546676 GGTGGGCCCCTGCCTCCTCATGG + Intronic
969779018 4:9381439-9381461 CGTCCTGTGCTGCCACCTCATGG - Intergenic
972316887 4:37935013-37935035 GGTGCTCCAAGGCCAGCTCAAGG - Intronic
981606560 4:146546573-146546595 GGGGCTGAGCAGCCACCTCATGG - Intergenic
982357994 4:154490569-154490591 GGTGCGCCGCCGCCTCCTCTCGG + Intronic
985309880 4:188586003-188586025 GGGTCTCTGCAGCCACCTCAGGG + Intergenic
986132266 5:4942452-4942474 GGTGCTGTGCTGCCACCTAGGGG + Intergenic
988536876 5:32076887-32076909 TGTGCTCTGCTGCCACCTTTGGG + Intronic
997377422 5:133407100-133407122 GCTGCTCCTCACCCACCTCAGGG + Intronic
997988879 5:138527349-138527371 TGTGCTCTGCTGCCACCCCTTGG + Intronic
998988597 5:147790008-147790030 GCTGCCCCACTGCCTCCTCATGG + Intergenic
1002813425 6:656686-656708 GGTGCTCCGCCGTCAGCTCCAGG + Exonic
1006861019 6:37171370-37171392 GGTGCTCCACCGCGACATCAAGG + Exonic
1008986649 6:57552124-57552146 GGTGCTCCACTGCCTCCTGCTGG - Intronic
1009174611 6:60444691-60444713 GGTGCTCCACTGCCTCCTGCTGG - Intergenic
1011410318 6:87059936-87059958 GGGCCTCAGCTGCCTCCTCATGG - Intergenic
1011702680 6:89970226-89970248 AGTGCTGTCCTGCCACCTCAAGG + Intronic
1019303650 7:322272-322294 GGCGCTCTGCTGCCACCTGGTGG - Intergenic
1019748229 7:2712555-2712577 GAGGCTCCGCTGCCACCTGGGGG + Exonic
1020000414 7:4752579-4752601 GGAGCCCGCCTGCCACCTCATGG + Intronic
1023843060 7:44107482-44107504 GGTGCTCCCGTGCCTCCACATGG - Exonic
1029477583 7:100794157-100794179 GGTGCACCTGTGCCAGCTCACGG + Exonic
1031020297 7:116620552-116620574 GGTGCTCAGCAGCCTCCCCATGG + Intergenic
1032727722 7:134606495-134606517 GGGGCTCTGCTGCCACCTAGTGG + Intergenic
1034282737 7:149865114-149865136 GGATCTCTGCTGCCACTTCATGG - Exonic
1034423013 7:150999059-150999081 GGTGCTCCAGGGGCACCTCAAGG - Exonic
1034912593 7:155009555-155009577 TGGGCTCCTCTGCCAGCTCAAGG - Intergenic
1034978220 7:155460003-155460025 GGGGATCCGCTGCCAGCTCGGGG - Intronic
1035122673 7:156581256-156581278 GGTGCTCCCACGCCACCCCAGGG - Intergenic
1036276457 8:7355398-7355420 CGTCCTGTGCTGCCACCTCATGG - Intergenic
1036344882 8:7954947-7954969 CGTCCTGTGCTGCCACCTCATGG + Intergenic
1036840222 8:12115714-12115736 CGTCCTGTGCTGCCACCTCATGG + Intergenic
1036862011 8:12361951-12361973 CGTCCTGTGCTGCCACCTCATGG + Intergenic
1037683208 8:21115936-21115958 GGTGATCCGCCCCCACCTCTTGG - Intergenic
1039885117 8:41650079-41650101 GGTCCTCCCCAGCCACCTCCCGG - Intronic
1040723138 8:50350133-50350155 GGTCCTTAGCTGCCTCCTCAGGG + Intronic
1042750783 8:72155362-72155384 GCAGCTCTGCTGCCACCTCCTGG + Intergenic
1049039115 8:140099080-140099102 GGTTCTCCGTCGCCACCGCAGGG + Intronic
1049799362 8:144510622-144510644 GGTGCTGCGCTTCCGCCTCGGGG + Exonic
1050462180 9:5886282-5886304 GGTTCTCTGCTGCCACCTAGTGG - Intronic
1056246225 9:84697702-84697724 TGTGCTGCGCTGCCCCCTCCTGG - Intronic
1062101018 9:134728628-134728650 CGGGCTCCGCTGCTTCCTCACGG + Intronic
1062540596 9:137040154-137040176 TGTGCTCCCCTGCCACCCCAGGG - Intronic
1185721936 X:2389258-2389280 GGTGCTCCAATGGCAGCTCATGG + Intronic
1189794406 X:44633739-44633761 GGTGCTCCGCTGCCACCTCAAGG + Intergenic
1200182565 X:154159632-154159654 GGTGCTCCGCTGCCTCCAGTTGG + Intergenic
1200188219 X:154196746-154196768 GGTGCTCCGCTGCCTCCAGTTGG + Intergenic
1200193869 X:154233886-154233908 GGTGCTCCGCTGCCTCCAGTTGG + Intergenic
1200199624 X:154271690-154271712 GGTGCTCCGCTGCCTCCAGTTGG + Exonic