ID: 1189794437

View in Genome Browser
Species Human (GRCh38)
Location X:44633847-44633869
Sequence ATGGCGGCTGGTTTTCTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189794429_1189794437 7 Left 1189794429 X:44633817-44633839 CCACTGGGTGTGAACTCGGATCC No data
Right 1189794437 X:44633847-44633869 ATGGCGGCTGGTTTTCTTGGTGG 0: 1
1: 0
2: 1
3: 6
4: 99
1189794428_1189794437 8 Left 1189794428 X:44633816-44633838 CCCACTGGGTGTGAACTCGGATC No data
Right 1189794437 X:44633847-44633869 ATGGCGGCTGGTTTTCTTGGTGG 0: 1
1: 0
2: 1
3: 6
4: 99
1189794423_1189794437 28 Left 1189794423 X:44633796-44633818 CCTGTTCTGAACACAGGCCACCC No data
Right 1189794437 X:44633847-44633869 ATGGCGGCTGGTTTTCTTGGTGG 0: 1
1: 0
2: 1
3: 6
4: 99
1189794426_1189794437 11 Left 1189794426 X:44633813-44633835 CCACCCACTGGGTGTGAACTCGG No data
Right 1189794437 X:44633847-44633869 ATGGCGGCTGGTTTTCTTGGTGG 0: 1
1: 0
2: 1
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189794437 Original CRISPR ATGGCGGCTGGTTTTCTTGG TGG Intergenic