ID: 1189798206

View in Genome Browser
Species Human (GRCh38)
Location X:44666416-44666438
Sequence GGTACTTTGGGAGGCCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189798198_1189798206 0 Left 1189798198 X:44666393-44666415 CCGTGGCTCACACCTGAAATCCC No data
Right 1189798206 X:44666416-44666438 GGTACTTTGGGAGGCCAAGCTGG No data
1189798197_1189798206 7 Left 1189798197 X:44666386-44666408 CCAAATGCCGTGGCTCACACCTG No data
Right 1189798206 X:44666416-44666438 GGTACTTTGGGAGGCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189798206 Original CRISPR GGTACTTTGGGAGGCCAAGC TGG Intergenic
No off target data available for this crispr