ID: 1189802589

View in Genome Browser
Species Human (GRCh38)
Location X:44705651-44705673
Sequence AAGGGCTGATAGAACTCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189802584_1189802589 2 Left 1189802584 X:44705626-44705648 CCCCTCAGATTCAATAATTTGCT No data
Right 1189802589 X:44705651-44705673 AAGGGCTGATAGAACTCTAGAGG No data
1189802581_1189802589 11 Left 1189802581 X:44705617-44705639 CCCACAGACCCCCTCAGATTCAA No data
Right 1189802589 X:44705651-44705673 AAGGGCTGATAGAACTCTAGAGG No data
1189802585_1189802589 1 Left 1189802585 X:44705627-44705649 CCCTCAGATTCAATAATTTGCTA No data
Right 1189802589 X:44705651-44705673 AAGGGCTGATAGAACTCTAGAGG No data
1189802586_1189802589 0 Left 1189802586 X:44705628-44705650 CCTCAGATTCAATAATTTGCTAG 0: 6
1: 28
2: 84
3: 253
4: 562
Right 1189802589 X:44705651-44705673 AAGGGCTGATAGAACTCTAGAGG No data
1189802583_1189802589 3 Left 1189802583 X:44705625-44705647 CCCCCTCAGATTCAATAATTTGC 0: 4
1: 25
2: 66
3: 146
4: 391
Right 1189802589 X:44705651-44705673 AAGGGCTGATAGAACTCTAGAGG No data
1189802582_1189802589 10 Left 1189802582 X:44705618-44705640 CCACAGACCCCCTCAGATTCAAT No data
Right 1189802589 X:44705651-44705673 AAGGGCTGATAGAACTCTAGAGG No data
1189802580_1189802589 12 Left 1189802580 X:44705616-44705638 CCCCACAGACCCCCTCAGATTCA No data
Right 1189802589 X:44705651-44705673 AAGGGCTGATAGAACTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189802589 Original CRISPR AAGGGCTGATAGAACTCTAG AGG Intergenic
No off target data available for this crispr