ID: 1189804880

View in Genome Browser
Species Human (GRCh38)
Location X:44725338-44725360
Sequence CAGGAGTTAAGGAGTTAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189804880_1189804886 14 Left 1189804880 X:44725338-44725360 CCTGATTAACTCCTTAACTCCTG No data
Right 1189804886 X:44725375-44725397 CAAGTTTTAACAGCACCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189804880 Original CRISPR CAGGAGTTAAGGAGTTAATC AGG (reversed) Intergenic
No off target data available for this crispr