ID: 1189805108

View in Genome Browser
Species Human (GRCh38)
Location X:44727709-44727731
Sequence AAGAAGAAGAAGAAGAAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5205
Summary {0: 13, 1: 55, 2: 313, 3: 900, 4: 3924}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189805105_1189805108 19 Left 1189805105 X:44727667-44727689 CCAGCCTGGGCAACAGAGCGAGA 0: 13859
1: 89903
2: 167511
3: 219270
4: 217578
Right 1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG 0: 13
1: 55
2: 313
3: 900
4: 3924
1189805104_1189805108 29 Left 1189805104 X:44727657-44727679 CCATTGTACTCCAGCCTGGGCAA 0: 2312
1: 45463
2: 120001
3: 189875
4: 216689
Right 1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG 0: 13
1: 55
2: 313
3: 900
4: 3924
1189805106_1189805108 15 Left 1189805106 X:44727671-44727693 CCTGGGCAACAGAGCGAGACTCT 0: 4406
1: 35153
2: 108095
3: 167633
4: 195830
Right 1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG 0: 13
1: 55
2: 313
3: 900
4: 3924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189805108 Original CRISPR AAGAAGAAGAAGAAGAAGGC CGG Intergenic
Too many off-targets to display for this crispr