ID: 1189812207

View in Genome Browser
Species Human (GRCh38)
Location X:44791132-44791154
Sequence TGTATTTTAAGATTACCTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189812207_1189812210 -5 Left 1189812207 X:44791132-44791154 CCGTTAGGTAATCTTAAAATACA No data
Right 1189812210 X:44791150-44791172 ATACAGAGATTTATCGGAGTGGG No data
1189812207_1189812209 -6 Left 1189812207 X:44791132-44791154 CCGTTAGGTAATCTTAAAATACA No data
Right 1189812209 X:44791149-44791171 AATACAGAGATTTATCGGAGTGG No data
1189812207_1189812211 11 Left 1189812207 X:44791132-44791154 CCGTTAGGTAATCTTAAAATACA No data
Right 1189812211 X:44791166-44791188 GAGTGGGCTTGACCCAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189812207 Original CRISPR TGTATTTTAAGATTACCTAA CGG (reversed) Intergenic
No off target data available for this crispr