ID: 1189812209

View in Genome Browser
Species Human (GRCh38)
Location X:44791149-44791171
Sequence AATACAGAGATTTATCGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189812207_1189812209 -6 Left 1189812207 X:44791132-44791154 CCGTTAGGTAATCTTAAAATACA No data
Right 1189812209 X:44791149-44791171 AATACAGAGATTTATCGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189812209 Original CRISPR AATACAGAGATTTATCGGAG TGG Intergenic
No off target data available for this crispr