ID: 1189815572

View in Genome Browser
Species Human (GRCh38)
Location X:44821543-44821565
Sequence ATCTGCTGGTACCTTGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189815572_1189815575 -9 Left 1189815572 X:44821543-44821565 CCAAAATCAAGGTACCAGCAGAT No data
Right 1189815575 X:44821557-44821579 CCAGCAGATTTGGTGTCTAGTGG No data
1189815572_1189815576 -8 Left 1189815572 X:44821543-44821565 CCAAAATCAAGGTACCAGCAGAT No data
Right 1189815576 X:44821558-44821580 CAGCAGATTTGGTGTCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189815572 Original CRISPR ATCTGCTGGTACCTTGATTT TGG (reversed) Intergenic
No off target data available for this crispr