ID: 1189820847

View in Genome Browser
Species Human (GRCh38)
Location X:44868870-44868892
Sequence ACTTCCACCCAGCAGTTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189820847_1189820855 18 Left 1189820847 X:44868870-44868892 CCTCACAACTGCTGGGTGGAAGT No data
Right 1189820855 X:44868911-44868933 TTGTGTGTGTGTGTTGGCGGGGG No data
1189820847_1189820856 21 Left 1189820847 X:44868870-44868892 CCTCACAACTGCTGGGTGGAAGT No data
Right 1189820856 X:44868914-44868936 TGTGTGTGTGTTGGCGGGGGTGG No data
1189820847_1189820853 16 Left 1189820847 X:44868870-44868892 CCTCACAACTGCTGGGTGGAAGT No data
Right 1189820853 X:44868909-44868931 AGTTGTGTGTGTGTGTTGGCGGG No data
1189820847_1189820851 12 Left 1189820847 X:44868870-44868892 CCTCACAACTGCTGGGTGGAAGT No data
Right 1189820851 X:44868905-44868927 GTGCAGTTGTGTGTGTGTGTTGG No data
1189820847_1189820854 17 Left 1189820847 X:44868870-44868892 CCTCACAACTGCTGGGTGGAAGT No data
Right 1189820854 X:44868910-44868932 GTTGTGTGTGTGTGTTGGCGGGG No data
1189820847_1189820858 30 Left 1189820847 X:44868870-44868892 CCTCACAACTGCTGGGTGGAAGT No data
Right 1189820858 X:44868923-44868945 GTTGGCGGGGGTGGGATGTGAGG No data
1189820847_1189820857 22 Left 1189820847 X:44868870-44868892 CCTCACAACTGCTGGGTGGAAGT No data
Right 1189820857 X:44868915-44868937 GTGTGTGTGTTGGCGGGGGTGGG No data
1189820847_1189820852 15 Left 1189820847 X:44868870-44868892 CCTCACAACTGCTGGGTGGAAGT No data
Right 1189820852 X:44868908-44868930 CAGTTGTGTGTGTGTGTTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189820847 Original CRISPR ACTTCCACCCAGCAGTTGTG AGG (reversed) Intergenic
No off target data available for this crispr