ID: 1189824532

View in Genome Browser
Species Human (GRCh38)
Location X:44904051-44904073
Sequence ATGTAGAAACTGAAAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 525}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189824532 Original CRISPR ATGTAGAAACTGAAAGCAGA AGG Intronic
900036807 1:418485-418507 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
900058433 1:654224-654246 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
902137057 1:14317161-14317183 ATGACAGAACTGAAAGCAGAAGG - Intergenic
902180976 1:14688127-14688149 ATGAAGACAGTAAAAGCAGAGGG - Intronic
902748728 1:18491389-18491411 ATTTAGGAACTGAAAGCAAGTGG - Intergenic
903133754 1:21295884-21295906 ATGAAGAAACTGAGACCTGAGGG - Intronic
903489246 1:23715384-23715406 AAGGACAAACTGAATGCAGAGGG - Intergenic
904313150 1:29642231-29642253 ATGAAGGAACTGTGAGCAGATGG + Intergenic
905270921 1:36786913-36786935 ATGAGGAAACTGAAAGCCTAGGG + Intergenic
906942397 1:50266718-50266740 ATGTATAAAATGAGGGCAGAGGG + Intergenic
907098416 1:51803552-51803574 GTGGAGAAACTGACAGCAAAGGG + Intronic
907273112 1:53302211-53302233 AGGTGGATTCTGAAAGCAGATGG + Intronic
907295798 1:53452886-53452908 ATTTTGTAACTGAAAACAGATGG - Intergenic
908100297 1:60784190-60784212 CTGTAGAAATTGTAAACAGAAGG - Intergenic
908240121 1:62181936-62181958 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
908525263 1:64981711-64981733 ATTTTGAGAATGAAAGCAGATGG - Intergenic
908708839 1:66992292-66992314 ATGTAGAAAGTAAAGGCAGTTGG - Intergenic
909102524 1:71367327-71367349 ATGGAGAAAATGACAGCAGCAGG - Intergenic
909355086 1:74698939-74698961 ATGTAAAAACTGAAATTACATGG + Intergenic
909503913 1:76365914-76365936 ATGTAGGAACTGGAAGGAGATGG - Intronic
909543442 1:76816683-76816705 TTGTTGAATCTGAAAACAGAGGG - Intergenic
910484336 1:87696269-87696291 ATACAGCAACTGAAAGCAAAAGG + Intergenic
911370635 1:96990748-96990770 ATGTAGAAACTGACAGTTGAAGG - Intergenic
912253648 1:108036813-108036835 ATGGAGAAACTGAGAGCCAAAGG - Intergenic
912936764 1:114010426-114010448 ATGTAGAAACTGTAAAGTGAAGG - Intergenic
913235698 1:116781130-116781152 ATTTAAAAACTGAATGCAAATGG + Intergenic
913454335 1:119015615-119015637 ATGTAGAAATAGAAAGAAAATGG - Intergenic
914377362 1:147084178-147084200 AGGTAGAAACTGTACGCCGACGG - Intergenic
914502996 1:148264025-148264047 AGGTAGAAACTCTACGCAGACGG + Intergenic
915069260 1:153252562-153252584 ATGGAGAAACTGAGATCTGAGGG + Intergenic
915447424 1:155981885-155981907 CTGGAGAATCTGAAAGCTGATGG - Intronic
916244939 1:162677837-162677859 ATGTGAAAGCTGAAAGCTGAGGG - Intronic
916339907 1:163721411-163721433 ATGTAGAAACTGGCACCACAAGG - Intergenic
917195256 1:172457528-172457550 ATGTAGAAAATGAACATAGATGG - Intronic
917563813 1:176189589-176189611 ATGTAAATCCTGCAAGCAGAAGG + Intronic
918574372 1:186038815-186038837 ATGTAATAACTGAAAGAAGAAGG - Exonic
918749508 1:188255346-188255368 ACCAAGAAACTGAAAGCAAATGG - Intergenic
918966160 1:191351691-191351713 ATTTATAAACTAAAAACAGATGG + Intergenic
919119474 1:193321303-193321325 ATGTACAAAATGATAGCACAAGG - Intergenic
919122672 1:193360707-193360729 AAGTAGAGACTGAAAAAAGAGGG + Intergenic
919223030 1:194656121-194656143 ATATAGAAATTGAAACTAGATGG + Intergenic
919701306 1:200633935-200633957 ATGTAGTCAATGAAAGTAGAAGG - Intronic
920421653 1:205838369-205838391 ATGTTTAAGCTGAAAGCTGAAGG - Intronic
920424086 1:205859643-205859665 ATGTAGAAAAGGAAATCAAAAGG + Intergenic
920751639 1:208683474-208683496 ATAAGGAAACTGCAAGCAGATGG - Intergenic
921501244 1:215906054-215906076 ATGAACAAATTGAAAACAGAAGG + Intronic
921555215 1:216590627-216590649 TTGGAGAAAATGAAGGCAGAAGG + Intronic
921877682 1:220217421-220217443 ATGGAAAAACAGAAAGGAGAGGG - Intronic
922170450 1:223150141-223150163 GTGGAGAAAGGGAAAGCAGAAGG - Intergenic
922458775 1:225798714-225798736 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
1063293243 10:4773441-4773463 CTGCAGAAAATGGAAGCAGAAGG + Intergenic
1063308283 10:4927527-4927549 ATCTACAGACTTAAAGCAGAGGG + Intronic
1063319208 10:5036996-5037018 ATGTAGAAAAGGAAATCAAAAGG + Intronic
1063576539 10:7266645-7266667 CTGTTGAAACTGAAGTCAGATGG - Intronic
1063949605 10:11209660-11209682 TTGTAGAAAGTGAAAGTAGGGGG + Intronic
1065569273 10:27052814-27052836 ATGTAGACACTGAAATCAACAGG + Intronic
1066035623 10:31480042-31480064 TTTTAAAAACTGAAAGCATAAGG - Intronic
1066148591 10:32589920-32589942 ATGCATAGACTGAAAGCATAGGG - Intronic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1068011613 10:51458593-51458615 TTGTAGAAACTGAGAGCCAAAGG + Intronic
1068347838 10:55807109-55807131 ATGAAGAAAGTGAAAGCCTATGG + Intergenic
1068505218 10:57891677-57891699 AGGGAGAAACTGAAAGAAGGTGG - Intergenic
1070222681 10:74466395-74466417 AAGTAGGGACTGAAGGCAGAGGG - Intronic
1071782732 10:88864480-88864502 GTGTAGAAATTAAAAGCACATGG + Intergenic
1072466487 10:95667363-95667385 ATGCAAAAACAGAAAGCAGATGG + Intronic
1073166992 10:101463785-101463807 ATATATAAACTGAAGTCAGAAGG - Intronic
1073341167 10:102745491-102745513 CCATAGAGACTGAAAGCAGACGG - Intronic
1073599852 10:104836029-104836051 ATGCAGCACCTGAAACCAGAGGG - Intronic
1074172693 10:110958838-110958860 TTCTAGAAACAGAAAGCAGTTGG - Intronic
1074232527 10:111551880-111551902 GTGAAGAAACTGAAAGCAAAAGG - Intergenic
1074662807 10:115681429-115681451 ATGTCAAAACTGATAGCAGTAGG + Intronic
1075276474 10:121097510-121097532 AAGTAGAAACTAAAAGCCTATGG + Intergenic
1075634501 10:124021079-124021101 ATGTAAAAGCTGAAAACTGATGG - Intronic
1075822945 10:125330107-125330129 ATGTAGAAACCAAAGCCAGAAGG + Intergenic
1078189175 11:9077366-9077388 AAATAGAAACTGAAGGCAGATGG + Intronic
1079766237 11:24396616-24396638 ATTTCAAAACTGTAAGCAGAGGG - Intergenic
1079896084 11:26119921-26119943 ATGCAGAAACTGAACTCAGCAGG - Intergenic
1079997615 11:27311603-27311625 CTGATGGAACTGAAAGCAGAAGG - Intergenic
1080077525 11:28168852-28168874 ATGCTGACACTGAAAACAGAGGG + Intronic
1080290297 11:30663615-30663637 ATGACGAAAGTGAAAGCTGAAGG + Intergenic
1081090014 11:38852787-38852809 AAGCTGAAACTGACAGCAGATGG - Intergenic
1084647870 11:70470692-70470714 ATGGAAAAACTGAAAGCACACGG + Intronic
1084869561 11:72088758-72088780 ATGAAGAAACTGAAACCCAAGGG - Intronic
1085758839 11:79224456-79224478 ATGCAAAAACTGAGAGCAGTTGG + Intronic
1086143511 11:83525173-83525195 ATGTAAACCCTGAAAGCCGATGG - Intronic
1086283157 11:85214190-85214212 AAGTAGCAGCTGAAAGGAGAGGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087848218 11:102997568-102997590 ATCTAGTTAATGAAAGCAGAAGG + Intergenic
1088039861 11:105366867-105366889 AAGTAGAAGCTGTAAGAAGAGGG - Intergenic
1088079194 11:105890075-105890097 ATGTAGAATATAAAAGCAGAAGG + Intronic
1088511813 11:110583369-110583391 AAGTAGAAAATGATAGCAGATGG - Intronic
1090422297 11:126583819-126583841 ATTTAGAAAGTGACAGCTGACGG + Intronic
1090734554 11:129599472-129599494 ATGGACAAACTGACAGGAGAAGG + Intergenic
1091131454 11:133150443-133150465 AGGTGGCAACTGAAAACAGAGGG - Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092654324 12:10668730-10668752 CTGGAGAAAGTGAAAGTAGAAGG - Intronic
1093121354 12:15275337-15275359 ATGTAGAAACTGAAGTCATGTGG - Intronic
1093745222 12:22732752-22732774 ATTTAGAAGCTGGAAGCTGAGGG + Intergenic
1094431923 12:30379518-30379540 ATGTATAAACTGTCAGAAGAAGG - Intergenic
1095167137 12:38987408-38987430 ATCTAGAAATTAATAGCAGAAGG - Intergenic
1095260526 12:40093949-40093971 GTGTATAAAAAGAAAGCAGAGGG + Intronic
1095304475 12:40623526-40623548 ATATAGAAACTCAAAGAAGAGGG - Intergenic
1095381520 12:41599646-41599668 ATGTAAACACTGAAAGTAAAGGG - Intergenic
1095744999 12:45648225-45648247 ATGGAGTAACCGAAAGCACAAGG + Intergenic
1096895830 12:54819946-54819968 ATTTAGAAACCTCAAGCAGAGGG + Intergenic
1097533240 12:60832650-60832672 ATGCAGAAAATGAAAGAAAAGGG - Intergenic
1097937790 12:65272977-65272999 ATGTGGAATGTGAAAGAAGAAGG - Intergenic
1098263489 12:68695572-68695594 ATGTAGGGACAGAAAGTAGATGG + Intronic
1098369601 12:69742780-69742802 AAGTTGAAAAGGAAAGCAGAAGG - Intronic
1098404701 12:70111549-70111571 ATGTATAGACTGAAAGTAGATGG + Intergenic
1098844994 12:75523871-75523893 ATGCAGGAACAGAAAACAGATGG + Intergenic
1099160160 12:79231155-79231177 ATTTAGAAGCAGAAACCAGAGGG + Intronic
1099231853 12:80035809-80035831 GTGTAGAATATGAAAGCATAAGG - Intergenic
1099491895 12:83299005-83299027 TTGCATAAACTGAGAGCAGAAGG + Intergenic
1099774409 12:87105567-87105589 ATGTATAAACTGAATGCTTATGG - Intergenic
1102562031 12:113769225-113769247 GAGGAGAAAATGAAAGCAGACGG + Intergenic
1102721061 12:115016617-115016639 ATGGAGAAACTGAGACCTGAGGG + Intergenic
1103889374 12:124227341-124227363 CTATAGAGACAGAAAGCAGATGG + Intronic
1104021987 12:124998564-124998586 CCGTAGAGACAGAAAGCAGATGG + Intronic
1105770774 13:23609943-23609965 TTTTAGAAACTGAAAGTTGAGGG + Intronic
1106979705 13:35263600-35263622 AAGTAGAAATTGAAAACAGGAGG + Intronic
1107003051 13:35573722-35573744 AAGAAGAAACTGAAAACAGCAGG + Intronic
1107026445 13:35806641-35806663 AGTTAGAAACTGAATGAAGAAGG - Intronic
1107782596 13:43920496-43920518 ATCTAGGATCTGAAATCAGAGGG - Intergenic
1107897114 13:44976269-44976291 ATGCAAAAAATGAAAGAAGAAGG + Intronic
1107957951 13:45534707-45534729 ATTTAGAAACCAACAGCAGAAGG - Exonic
1108620580 13:52179586-52179608 ATGAAGAAACTCAATACAGATGG - Intergenic
1109115035 13:58371279-58371301 ATCAAGAGACTGAAAGCAAATGG - Intergenic
1109287991 13:60434738-60434760 AAGAAGAAACTGACACCAGAGGG - Intronic
1109568198 13:64147923-64147945 ATGTTGTAACCGAAAGAAGAAGG + Intergenic
1109575152 13:64246229-64246251 ATCTAGAAACTGAAATGATAGGG + Intergenic
1110236209 13:73220579-73220601 TTCTACAAACTGGAAGCAGAAGG - Intergenic
1111905809 13:94254903-94254925 ATGTAAAAACTTAGAGCATAAGG - Intronic
1111914769 13:94349367-94349389 ATGAAGAAGCTGAAACCAAAAGG - Intronic
1111995497 13:95162209-95162231 ATGTGGAAACTAAAGGAAGAAGG - Intronic
1113216044 13:108041919-108041941 ATTTAGGAACTAAAAGCAGGAGG - Intergenic
1113590141 13:111492966-111492988 ATGCAGAAACTGCAATCAGGAGG + Intergenic
1113670726 13:112173937-112173959 ATTTAAAAACTGAAGACAGAAGG + Intergenic
1113820818 13:113211161-113211183 ATATAGTAACAGAAAGCAAATGG - Intronic
1113971515 13:114194997-114195019 GTATGAAAACTGAAAGCAGAGGG + Intergenic
1114383674 14:22235008-22235030 ATGTAGGAACTGAAAGGGCAAGG - Intergenic
1115074652 14:29372928-29372950 ATATAGACATTGAAACCAGATGG - Intergenic
1115236041 14:31209212-31209234 ATGTAGACACTGAAAGGAAAGGG + Intergenic
1115448255 14:33516933-33516955 ATCTAGATACAGAATGCAGAGGG - Intronic
1115621463 14:35144572-35144594 ATGAAGAAAATGAAAGCTCATGG + Intronic
1116932688 14:50705440-50705462 AAGCAGTGACTGAAAGCAGAAGG - Intergenic
1117456443 14:55901948-55901970 ATGAAGAAACTGGGAGAAGAGGG + Intergenic
1118017003 14:61670842-61670864 ATATAGAAACTGGAGGCAGTTGG - Intergenic
1118147527 14:63156792-63156814 TTGTAGAAACAGAGAGTAGAAGG - Intergenic
1118365572 14:65092740-65092762 ATATAAAAAATGAAAGCATAAGG + Intronic
1118429701 14:65704425-65704447 ATATAGGAACAGAAAGCAGTAGG - Intronic
1120027971 14:79607584-79607606 ATTTAGATAATTAAAGCAGAGGG + Intronic
1122045847 14:99022758-99022780 ATGAGGAAACTGAAATTAGAAGG - Intergenic
1122529041 14:102411977-102411999 ATGTGGAATCTGAAACCACATGG + Intronic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122845481 14:104494699-104494721 ATGAAGGAACTGGAAGCTGATGG + Intronic
1123901921 15:24885959-24885981 ATGCAGAAACAGAAACCAGACGG - Intronic
1124933095 15:34143008-34143030 GTATAGAAATTGAAAGAAGAGGG - Intronic
1125064819 15:35469819-35469841 ACATATAAACTGAAAGAAGAGGG + Intronic
1125097348 15:35870209-35870231 AGGTAGAATATCAAAGCAGAAGG - Intergenic
1125279461 15:38028193-38028215 ATGAAGAAAGTGAAAACAGGGGG - Intergenic
1125385311 15:39130676-39130698 ATGAAGAAACAGGAAGCAGCTGG + Intergenic
1125806860 15:42500717-42500739 AGGTAGAAACTTGAAACAGAAGG + Intronic
1126138768 15:45418997-45419019 ATGTATAAACTGAAATTGGAAGG + Intronic
1126292879 15:47101132-47101154 ATGTAGCAAATGCAAACAGAAGG + Intergenic
1126690256 15:51283639-51283661 ATGTAGAAAAGGAAATCAAAAGG + Intronic
1126814330 15:52439755-52439777 ATGTAGAAACTGGTAGGAGAAGG + Intronic
1126935950 15:53708019-53708041 ATGTGGAAGGTGAAGGCAGAGGG - Intronic
1127398196 15:58560145-58560167 ATTTAGTTACTGAAAGCAAATGG - Intronic
1128918702 15:71591365-71591387 ATGCATAAACAGAAAACAGAAGG - Intronic
1129531024 15:76264845-76264867 ATGTAGAAATGGAAATCAAAAGG + Intronic
1129882554 15:79016860-79016882 CTGTAGAAACTGAAAGGGCAGGG - Intronic
1130252491 15:82309074-82309096 ATGGAAAGACTGAAAGGAGAAGG + Intergenic
1130408230 15:83622353-83622375 ATCTAGAGAATGAAAGCTGATGG - Intergenic
1130710481 15:86275903-86275925 ATGAAGAATCTGAAAGAAGTTGG - Intronic
1130731488 15:86497879-86497901 ATTGAGAGACTGAAAGCAGATGG - Intronic
1130832821 15:87618904-87618926 TTGTAAAAACTGAAAACAAATGG + Intergenic
1131435802 15:92420625-92420647 ATGTTTAAATTGAAGGCAGAAGG + Intronic
1131901045 15:97088304-97088326 ATGTAGACAATGAAGGCATAGGG + Intergenic
1131999454 15:98164105-98164127 AAGGAGAAACTGAAGTCAGAGGG - Intergenic
1132170661 15:99650706-99650728 AATTAGAAAATAAAAGCAGATGG + Intronic
1132444979 15:101907683-101907705 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1133855085 16:9542152-9542174 AAGAAGAAACTGAAACAAGAAGG + Intergenic
1134021184 16:10922619-10922641 ATGAAGAAGCTGAAGCCAGAGGG - Intronic
1134042762 16:11080994-11081016 ATGCAGAAACTGGCAGCAGATGG + Intronic
1134780915 16:16894898-16894920 ATGAAGAAACTGAGTACAGAAGG - Intergenic
1134788955 16:16971160-16971182 ATCTAGAAACTGAAGGAAGATGG - Intergenic
1135635808 16:24074385-24074407 ATGTGGAACCTGACAGCTGAGGG - Intronic
1137324541 16:47421110-47421132 ATGTATAGACTGAAAGCTAAGGG - Intronic
1137754643 16:50891730-50891752 CTCTAGAAACTGGGAGCAGAGGG + Intergenic
1137906650 16:52330147-52330169 ATGCAGAAACGTGAAGCAGAGGG - Intergenic
1138799947 16:60015498-60015520 ATTTTGAAACTGAAAGAAAATGG + Intergenic
1138806635 16:60097768-60097790 ATGTATAGACTGAAAACAAAGGG - Intergenic
1139020056 16:62737680-62737702 CTGTAGAAAATTAAAGCAGATGG - Intergenic
1139148373 16:64350292-64350314 ACGGACAAACTGAAAGCAAATGG - Intergenic
1139152637 16:64401998-64402020 ATGAAAAAACTGAGATCAGAGGG + Intergenic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142787914 17:2238876-2238898 AAGAAAAAACTGAAAGCAGAAGG + Intronic
1144171536 17:12664126-12664148 ATGTAGAAGAGGGAAGCAGAAGG + Intergenic
1144439115 17:15265487-15265509 ATGGAGAAACTGGAATCAGAAGG + Intergenic
1144694337 17:17291666-17291688 CTATAGTGACTGAAAGCAGATGG - Intergenic
1144707537 17:17379511-17379533 ATACAGAAACAGAAAGCGGATGG - Intergenic
1144792444 17:17868128-17868150 ATGGAGAAACTGGAATCACATGG + Intronic
1144949516 17:18986480-18986502 ATGGAGAAACTGAGATCCGAGGG - Intronic
1146439415 17:32880829-32880851 ATGTTGAGACTGAGAGCGGAGGG - Intergenic
1147436098 17:40417175-40417197 ATGCAGGAACTGAAAGAAGTGGG - Intronic
1148188380 17:45661159-45661181 ATATAGAAGATGAAACCAGAGGG - Intergenic
1148470771 17:47891911-47891933 AGAAAGAAACTGAAAGCAGTTGG + Intergenic
1148661016 17:49332852-49332874 CTGGAGAAACTGAAAGAAAAGGG - Intronic
1148674022 17:49434709-49434731 ATGTGGAAAAAGAAAACAGATGG + Intronic
1149286387 17:55169477-55169499 ATGTTGAGAGTGAAAGCACAGGG + Intergenic
1149341331 17:55689261-55689283 ATGAAGGAACTGAAAGTGGATGG - Intergenic
1149536285 17:57436075-57436097 ATGAAGCAATTAAAAGCAGAAGG + Intronic
1150005965 17:61469179-61469201 CTCTAGAAAGTGAGAGCAGAGGG + Intronic
1151585599 17:75006606-75006628 ATGATGAAGCTGAAACCAGAAGG + Intergenic
1151588237 17:75024806-75024828 ATGTAGAAAAGGAAATCAAAAGG + Intergenic
1152094771 17:78266729-78266751 ATGAGGAAACGGATAGCAGAGGG + Intergenic
1153396716 18:4630306-4630328 ATGCAGAAGCTGGAAGCAGAAGG + Intergenic
1153496022 18:5700441-5700463 CTGAAGAAGCTGAAAGGAGATGG + Intergenic
1153791020 18:8579555-8579577 ATTTAGATACTAGAAGCAGATGG + Intergenic
1154094889 18:11404089-11404111 CTGAAGAAAATGATAGCAGATGG + Intergenic
1154162470 18:11990434-11990456 ATAGAGAAGATGAAAGCAGAAGG + Intronic
1155415080 18:25589412-25589434 AAGTAGAAACTGGAAACAGCAGG + Intergenic
1155434090 18:25792982-25793004 ATGGGGAAAGAGAAAGCAGAGGG - Intergenic
1155566306 18:27138407-27138429 ATGTAGAAGCTGGCAGGAGAAGG - Intronic
1155680957 18:28484930-28484952 TTGTAAAAACTGAAAACAAAGGG + Intergenic
1155750745 18:29420196-29420218 ATCTAGAACCTGAGAGCAAAGGG - Intergenic
1155795293 18:30027851-30027873 ATGAAGAAATGGAAAGCAAAAGG - Intergenic
1155800402 18:30094735-30094757 ATGAAGAAACAGGAAACAGATGG - Intergenic
1155906060 18:31452725-31452747 ATGAAGAAACTGAAAGATTAAGG + Intronic
1156278154 18:35604898-35604920 AAGTAGAAACTAAAACCAGGTGG - Intronic
1156714167 18:39986712-39986734 ATAAAGAAACTGAAAACAAATGG + Intergenic
1157074472 18:44449996-44450018 CTGTGGGAACAGAAAGCAGAAGG - Intergenic
1159132788 18:64299370-64299392 ATATAGAAAATTAAAGTAGATGG + Intergenic
1159186699 18:64984147-64984169 ATCTAGAACAGGAAAGCAGATGG + Intergenic
1159362063 18:67418286-67418308 AAGGAGAAACTCACAGCAGAAGG - Intergenic
1159426771 18:68299181-68299203 CTGTAGAAACTCAGAGTAGATGG - Intergenic
1159831283 18:73280812-73280834 ATATAGAAATTAACAGCAGAAGG + Intergenic
1160282733 18:77507776-77507798 ATGTGAAGACTGACAGCAGAAGG + Intergenic
1160640336 19:126034-126056 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1162693440 19:12452550-12452572 ATGTAGAAAAGGAAATCAGAAGG + Intronic
1163901097 19:20100886-20100908 ATGTATCACCTGAGAGCAGAGGG + Intronic
1164691022 19:30210829-30210851 ATGCAGAAACTGAGAGCTCAGGG - Intergenic
1164871279 19:31646134-31646156 ATGTAGAAACAGAGAGCAGAAGG - Intergenic
1166233815 19:41441755-41441777 ATTGAGAAACTAAAAGCAGACGG + Intergenic
1168198354 19:54792955-54792977 ATAAAGAAAGTGAAACCAGATGG - Intronic
1168367510 19:55801384-55801406 ATGTAGAAATTGAAATCAAAAGG + Intronic
1168454579 19:56496453-56496475 TTGGAGAAACTGAAAGGGGAAGG + Intergenic
1168623431 19:57897398-57897420 ATGTAGAAAAGGAAATCAAAAGG + Intronic
925119745 2:1409018-1409040 TTGTAGAAACGCAAAGCACAGGG + Intronic
926317232 2:11719500-11719522 ATTTGGAAAGTGAAAGCAAAGGG - Intronic
926458644 2:13100242-13100264 CTGTAGAAACTGTAAGCCTAGGG + Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
928864278 2:35898724-35898746 AAGTAGAAATTGATAGCATAAGG - Intergenic
929544574 2:42847348-42847370 AGGAAGAAACTGGAAGCAGAAGG - Intergenic
929991569 2:46793904-46793926 CTGTTGAAACTGAAAGGGGAGGG + Intergenic
930306654 2:49683323-49683345 TAATAGAAGCTGAAAGCAGAAGG + Intergenic
931483189 2:62663914-62663936 ATCAAGAAACTATAAGCAGAAGG - Intergenic
931686088 2:64795341-64795363 ATGTGGAAACTGAGATCAGGTGG + Intergenic
931753142 2:65348301-65348323 ATATAGAAAGCCAAAGCAGAGGG - Intronic
932190954 2:69741592-69741614 AAGTAGAAAGTGAAATCTGAAGG - Intronic
932919177 2:75890316-75890338 ATGTAGAAAGTAAAAGAGGATGG + Intergenic
932931937 2:76051261-76051283 GTGAAAAAACTCAAAGCAGATGG - Intergenic
933287814 2:80403147-80403169 ATGTTGAAGCTGGAAGCAAAAGG + Intronic
933381672 2:81555285-81555307 ATATAAAAACAGAAAGCACAAGG + Intergenic
933599762 2:84317466-84317488 ATGTGGAAACTGAGGCCAGAAGG - Intergenic
935615369 2:105074614-105074636 ATGTAGGAATTAAAAGCACATGG + Intronic
936247290 2:110839361-110839383 AAGTAGAAACTGTAGACAGAAGG - Intronic
936551116 2:113440370-113440392 ATGTGAAAACTGAAAGGAAAGGG - Intronic
937037373 2:118793268-118793290 AGGTAGAAACAGGAAGCATAGGG + Intergenic
937499373 2:122461834-122461856 ATGGAGAAAATTAAGGCAGACGG + Intergenic
938027179 2:127959884-127959906 ATGTAATAACTGAAATAAGACGG + Intronic
938926634 2:136049078-136049100 TTGAAGAAACTGACAGCTGAAGG + Intergenic
940556348 2:155233362-155233384 ATGTATAATATGAATGCAGAAGG - Intergenic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942569750 2:177302025-177302047 AGGAAGAATCTGAAAGCAGGAGG + Intronic
944393724 2:199246326-199246348 ATGAAGTTACTGAGAGCAGAAGG - Intergenic
944959913 2:204860439-204860461 ATGGAGAAACTGCTGGCAGATGG + Intronic
945060565 2:205905133-205905155 CTGTAGTAATAGAAAGCAGATGG - Intergenic
945428472 2:209736782-209736804 ATATACAAACGGACAGCAGAAGG + Intergenic
946611644 2:221464770-221464792 ATGTAGCAACTAAAAGCTGTTGG - Intronic
946629002 2:221646033-221646055 ATTTAGATAGTGAAAACAGAAGG - Intergenic
946944566 2:224807347-224807369 ATGTAGAAAGTGGTAGGAGAAGG + Intronic
947542727 2:230990117-230990139 ATGGAGAAACTGAACACAGTCGG + Intergenic
948255404 2:236564706-236564728 TTGTAGAAACCTATAGCAGAGGG - Intergenic
1168765288 20:378117-378139 ATGTTTAAACTAAAAGCTGAGGG - Intronic
1169756189 20:9045779-9045801 CTTTAGGAACTGGAAGCAGAGGG + Intergenic
1169942144 20:10948703-10948725 ATATAGAAATTGAAAGAAAACGG - Intergenic
1170696121 20:18660545-18660567 AAGCAGAAACTGAAAGAAAAAGG + Intronic
1170791157 20:19510691-19510713 ATGTAGATACTGTAAGAAGGTGG + Intronic
1172182421 20:33011511-33011533 ATGCAGAAACTAAAGGCATAGGG + Intronic
1173062184 20:39673113-39673135 AGCTAGAAATTGGAAGCAGAGGG - Intergenic
1173248270 20:41350767-41350789 GTCCAGAAACTGAAAGCAGCTGG + Intronic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1173321740 20:41993626-41993648 AAGTAGAAACTGGAAAAAGAGGG + Intergenic
1173456831 20:43209563-43209585 ATGGAAAAATAGAAAGCAGATGG + Intergenic
1174158615 20:48534298-48534320 ATTTTTAAACTGAAAGAAGATGG - Intergenic
1174948856 20:55021071-55021093 ATTTAGGAACTTAAAGGAGATGG - Intergenic
1175370023 20:58481880-58481902 ATTTAGAGACTGAAGGCAAAGGG + Intronic
1177636894 21:23798957-23798979 ATGTAAATACTGAAAGCTTAGGG - Intergenic
1177963764 21:27701679-27701701 ATGTACAAACTGAAACGACAGGG + Intergenic
1178537461 21:33422258-33422280 ATGTAGGAACTGGAATCTGAGGG - Intronic
1182491881 22:30678022-30678044 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
1182787669 22:32921042-32921064 ATTTAGAATCTGACAACAGAAGG - Intronic
1182852144 22:33484466-33484488 ATGCAGAAACTCTAAGAAGATGG - Intronic
1183560202 22:38566702-38566724 ATTAAGAAACTGAAATCAGTAGG - Exonic
949454909 3:4228054-4228076 CTGCAGGAACTAAAAGCAGAAGG + Intronic
950732837 3:14977165-14977187 AAGTAGAAGCTGGAGGCAGATGG - Intronic
951061396 3:18211052-18211074 ATATAAAAACAGAAAGTAGATGG + Intronic
951259677 3:20492888-20492910 ATATATAAACTGAAAGTAAATGG - Intergenic
953160290 3:40413225-40413247 TTGAATAGACTGAAAGCAGAAGG - Intronic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
955313717 3:57916850-57916872 AGGTAGAAACTGGACACAGAAGG - Intronic
955523594 3:59798738-59798760 ATGCTGAAACTGAAAACTGAAGG - Intronic
955600865 3:60643605-60643627 ATGTAGATGCTGTACGCAGATGG + Intronic
956504046 3:69918653-69918675 ATGAGGAAACTGAGGGCAGAGGG - Intronic
957894690 3:86406629-86406651 ATGAAGAAACTGAAACAAGGAGG - Intergenic
958098327 3:88975520-88975542 ACATATAAACTGAAAGCAAATGG + Intergenic
959305922 3:104665982-104666004 ATGTTCAAAAAGAAAGCAGAGGG + Intergenic
959434371 3:106296175-106296197 TTGTAGAAACACAAAGCAGGCGG + Intergenic
959637393 3:108590302-108590324 ATGTAGAAATTGTAAGAATAGGG + Intronic
960424516 3:117489744-117489766 ATGTAGAAACTGACAATAGCTGG - Intergenic
961178221 3:124853646-124853668 AAGTAGAACCTGGAAGGAGAAGG + Intronic
961549888 3:127663372-127663394 ATCTAGACACTGGAAGCAGATGG - Intronic
961724926 3:128921614-128921636 ATGTAGAAAAGGAAATCAAAAGG + Intronic
962030686 3:131597150-131597172 ATGAAGAAACTAAGAACAGAGGG + Intronic
962076319 3:132085912-132085934 ATCAAGATACTGAAAGCATATGG + Intronic
962103037 3:132362669-132362691 ATGTTCAAACTGAAACCTGAAGG + Intronic
962272700 3:133989711-133989733 AACTAAAAACTAAAAGCAGAGGG - Intronic
962417168 3:135193572-135193594 AAGCAGAAGCTGAGAGCAGAGGG + Intronic
962621019 3:137178951-137178973 ATGTTGAAACTGAAACCCTAAGG - Intergenic
962771377 3:138613434-138613456 ATCTAGAAAGTGAAAGGACAAGG - Intronic
963217682 3:142768382-142768404 ATGGATAAACTAATAGCAGAAGG - Intronic
963554217 3:146766650-146766672 AAGTAAAAACTGAAAGGAGAAGG + Intergenic
963935311 3:151046319-151046341 ATATAGATAGAGAAAGCAGATGG - Intergenic
964006952 3:151842243-151842265 TTGTAATAACTCAAAGCAGAAGG + Intergenic
964102764 3:153006656-153006678 ATGAAGAAACTGAAGGCAAGAGG - Intergenic
964514213 3:157489595-157489617 ATGTAGAAAATTAACGCAGAGGG - Intronic
964561097 3:157997421-157997443 AAGTAGAAGCAGAAGGCAGAAGG - Intergenic
964638490 3:158883851-158883873 ATCTATAAAATGAAAGCAGTAGG + Intergenic
965783625 3:172314066-172314088 CTGTAGAAACTACCAGCAGAAGG - Intronic
966589974 3:181671501-181671523 ATGTAGAAAATGAGAAGAGATGG + Intergenic
966742307 3:183245248-183245270 ACATAGAAACAGAAAGGAGAAGG + Intronic
967315665 3:188150149-188150171 GTGTTCAAACTGAGAGCAGATGG + Intergenic
967544295 3:190705904-190705926 ATGCAGAAACAAAAAACAGATGG + Intergenic
968311179 3:197684201-197684223 ATGTAGATGCTGACATCAGAAGG - Exonic
968390906 4:192334-192356 ATGTATCAACTGAGAGCACAGGG - Intergenic
968874138 4:3256365-3256387 ATCCCGAAAATGAAAGCAGATGG + Intronic
968933429 4:3596827-3596849 ATGTAAAAAATGAAACCACAGGG - Intergenic
969486779 4:7476775-7476797 GTGGAGAAAATGGAAGCAGAGGG - Intronic
969862042 4:10044862-10044884 TTATGGAAACAGAAAGCAGAAGG + Intronic
969923108 4:10559427-10559449 CTGGAGAAATTGAAAGCTGATGG - Intronic
970828392 4:20306147-20306169 ATTCTGAAACTGAAAGCAGCAGG + Intronic
970881068 4:20931713-20931735 ATGTAGAATCTTAAAAAAGAAGG + Intronic
970905056 4:21205956-21205978 AGGCAGAACCTGAATGCAGATGG - Intronic
971259494 4:25043402-25043424 AGGTAGAAGCTGAAAGAAGATGG + Intergenic
971303382 4:25460480-25460502 ATGTAGAAAATGAAAAAGGAGGG - Intergenic
971814009 4:31463666-31463688 ATCTTGACACTGAAAGCAAAAGG + Intergenic
972491243 4:39589566-39589588 TTCTAGAAAGAGAAAGCAGATGG - Intronic
972601676 4:40578524-40578546 AAGTAGAAAATGGAGGCAGAGGG - Intronic
974008011 4:56579283-56579305 AATTGGAAACTGATAGCAGAAGG + Intronic
974381988 4:61152942-61152964 ATGGAGAAACTGGAAACTGAGGG + Intergenic
974576496 4:63730574-63730596 ATTTAGAAAATAGAAGCAGATGG - Intergenic
974615526 4:64274336-64274358 AAGTAGAAACTGGAGGTAGAAGG + Intergenic
974911763 4:68131696-68131718 ACGTAGTCACTGAAAGCTGAAGG - Intergenic
975214768 4:71740513-71740535 ATGTAGAAGCTGCAAGCGGCAGG + Intergenic
975237998 4:72023258-72023280 ATGTAGAAACTTAAGGGATAGGG - Intergenic
975663093 4:76706928-76706950 ATGTCGAAATTGAAACCTGAAGG + Intronic
976211244 4:82672659-82672681 TTTTAGAAAATAAAAGCAGAGGG + Intronic
976516946 4:85979517-85979539 TCATAGAAACTGAAAGCAGAAGG - Intronic
976576746 4:86681145-86681167 TAGAAGAAACTTAAAGCAGAGGG - Intronic
976648152 4:87406829-87406851 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
978453136 4:108858819-108858841 ATGGAAAAAATGAAAGTAGAAGG + Intronic
978568808 4:110113810-110113832 ATGTAGAAATAGAATTCAGAAGG + Intronic
979064321 4:116108989-116109011 ATGTGGAGGCTGAAAGCAAAGGG - Intergenic
980190136 4:129514162-129514184 ATGTAGAAAACCAAATCAGAAGG + Intergenic
980525879 4:133990843-133990865 ATCCAGAAACTGAGAGCAAAGGG - Intergenic
980974867 4:139600842-139600864 TTATAGAAACTGAAAGTAGAAGG - Intronic
981546557 4:145899859-145899881 ATGTTCAAACTGAAAGAGGAGGG - Intronic
981647521 4:147017403-147017425 AGGTAGAAAATGAAAGCTCAAGG + Intergenic
981791923 4:148547619-148547641 CTGTAGAAAGTGCAAGAAGATGG - Intergenic
982264460 4:153525639-153525661 ATTAAGAAACTGAAAGAAAAAGG - Intronic
982658629 4:158179250-158179272 ATGTAGAAACCGGAAAAAGAAGG + Intergenic
982929271 4:161381808-161381830 ATGTAGCAAGTGAAAATAGAAGG + Intergenic
983866184 4:172769662-172769684 ATGTAAAGACAGAAAGCAAATGG - Intronic
983871327 4:172827920-172827942 ATGTCTAAAGTGCAAGCAGAAGG - Intronic
983903587 4:173162504-173162526 ATGTATAAATTGAAATCTGAAGG + Intergenic
984075347 4:175170703-175170725 ATGTCGGAACAGAAAGCATAGGG - Intergenic
984299595 4:177898008-177898030 ATGCACAAACAGAAAGCACAAGG - Intronic
985047773 4:185957686-185957708 ATTTAGAAAAAGAAAGCAGATGG + Intergenic
986160573 5:5224587-5224609 TTCAAGAAACTGAAAGCAGTTGG - Intronic
987923389 5:24311449-24311471 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
989261107 5:39421262-39421284 TTGTGAAAACTGAAAGCAAATGG - Intronic
989669471 5:43898223-43898245 ATGTAGAAAGTGAAATGGGATGG + Intergenic
989966551 5:50471920-50471942 ATGTAGGTAGTGAAAGAAGAAGG - Intergenic
990550588 5:56873627-56873649 ATGTAGGATCTAAAACCAGACGG + Intronic
991044161 5:62205600-62205622 ATGTTGTAACTCAAACCAGAAGG - Intergenic
991559740 5:67937231-67937253 ATTTAGAGACAGAAGGCAGATGG + Intergenic
991684885 5:69172677-69172699 AAGAAGAAACTAAAAGCAGAAGG - Intronic
992489530 5:77228688-77228710 ATGGAGAAAATGAAAGATGAGGG + Intronic
992944892 5:81800326-81800348 ATTTTGTAGCTGAAAGCAGATGG + Intergenic
993121917 5:83785287-83785309 AAGGAGAAGCTGAAAGCACAGGG - Intergenic
993155405 5:84215836-84215858 CAGTAGAAACTGAAGCCAGAAGG + Intronic
993162297 5:84307895-84307917 GGGTAAAAACTGAAATCAGAAGG + Intronic
993918836 5:93774540-93774562 ATGTAAGAACTGAAACAAGAAGG - Intronic
994201117 5:96977327-96977349 ATGATGACACTGCAAGCAGAGGG + Intronic
994490491 5:100437073-100437095 ATGTAGAAACTAATAACAAAAGG + Intergenic
994598289 5:101867736-101867758 ATGGAAAAACAGAAATCAGAGGG + Intergenic
994733692 5:103525230-103525252 ATGATGAAACTTAAAGGAGAAGG - Intergenic
996004466 5:118404525-118404547 ATGGATAAACTGAAAGAAGTGGG - Intergenic
996127193 5:119739928-119739950 ATATAGTAAGTGAAAGCATAAGG - Intergenic
996542876 5:124648273-124648295 ATGCCTAAACTGGAAGCAGAAGG - Exonic
996766488 5:127039565-127039587 CTGTAGAGACAGAAAACAGATGG + Intergenic
997106645 5:131028249-131028271 ATTTTGAAACTGAAAAGAGATGG + Intergenic
998180304 5:139933384-139933406 AAGTAAAAACTAAAAGCAGAAGG + Intronic
998440503 5:142157383-142157405 ATGTGGAATCAGGAAGCAGATGG - Intergenic
998659445 5:144219867-144219889 CAGGAGAAACTGAGAGCAGATGG + Intronic
998917646 5:147033218-147033240 AAGTAGAAATTGAAAATAGAAGG - Intronic
999037810 5:148373202-148373224 ATGAAGAAAATGAAAATAGATGG + Intergenic
999590141 5:153135995-153136017 ATGAAGAAACTGAGTCCAGAAGG - Intergenic
999882827 5:155886286-155886308 AGATAGATACAGAAAGCAGATGG - Intronic
1000047673 5:157535014-157535036 ATGAGGAAACTGAGAGGAGAAGG - Intronic
1000360828 5:160445675-160445697 ATGTATCAACTGAAAGTAAAAGG + Intergenic
1000378956 5:160611762-160611784 ATGGAGAAAACGAAAGAAGACGG - Intronic
1000604232 5:163311186-163311208 TTTTGGAAACTGAAAGCAGATGG - Intergenic
1001418564 5:171568161-171568183 GTGTATAAAATGAAAGTAGAAGG - Intergenic
1001661282 5:173395432-173395454 CTCTAGAAACTGCCAGCAGAGGG + Intergenic
1002737014 5:181400381-181400403 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1002747685 6:74437-74459 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1005444844 6:25911666-25911688 ATGGATAAAATGAAAGGAGATGG - Intergenic
1005693184 6:28327210-28327232 ATGCATAAACTGAAGGCACAGGG + Intronic
1007075468 6:39063469-39063491 ATGGTGAAACTGACAGCAGTGGG - Intronic
1007080554 6:39099533-39099555 ATATAGAAAATGAAAGCAATGGG + Intergenic
1007932442 6:45704472-45704494 ATCTAAATACAGAAAGCAGAGGG + Intergenic
1008279451 6:49578610-49578632 ATGTAGAGGCTGAAAGCCTAGGG + Intergenic
1008580016 6:52898204-52898226 ATGTGGAAAATGCAAGCAGGTGG - Intronic
1008758478 6:54825530-54825552 GTGTAGAAACTGGAAACAGTGGG - Intergenic
1009159004 6:60258674-60258696 ACGATGAAACTGAAAGGAGATGG - Intergenic
1009569404 6:65363876-65363898 ATTTATAAACTGAAATCAGTGGG - Intronic
1009747867 6:67842774-67842796 ATGTATAAGCTAAAAGCAAAAGG + Intergenic
1010089369 6:71961891-71961913 AAGTAGAAAATAAAAGCAAATGG + Intronic
1010186677 6:73152331-73152353 AGGTAGAAAATGAAAGAGGAAGG - Intronic
1010685997 6:78856072-78856094 ATGTAGAAAAGGAAATCAAAAGG + Intergenic
1011164895 6:84435576-84435598 GTTAAGAGACTGAAAGCAGATGG + Intergenic
1011457408 6:87566873-87566895 ATGTGGACAAGGAAAGCAGACGG + Intronic
1012090357 6:94886134-94886156 ATTTAGAAGATAAAAGCAGAGGG - Intergenic
1012265982 6:97143737-97143759 GGGTAGAAAATGAAAGCAGGAGG + Exonic
1012563387 6:100615490-100615512 ATGCAAAAACTGAAATTAGAAGG - Intronic
1013252957 6:108352924-108352946 ATGTAGAAACTAGATACAGAGGG + Intronic
1013464563 6:110406474-110406496 CTGTAGAAACAGAGAGTAGATGG - Intronic
1013597188 6:111670788-111670810 GGGGAGAAACTGGAAGCAGAGGG + Intronic
1013744842 6:113333573-113333595 ATGGGGAAACTGGAAGGAGAAGG + Intergenic
1014080392 6:117280418-117280440 AGGTAGCAACTGGAAGAAGATGG - Intergenic
1014962671 6:127706360-127706382 ATGTAGGAATTTGAAGCAGAAGG + Intergenic
1014986048 6:128011059-128011081 ATGTAGATATTGAAAACAGGTGG + Intronic
1016174471 6:141062395-141062417 ATTTAGAAACTGAAGTCAGGAGG + Intergenic
1016683143 6:146853412-146853434 TTACAGAAACAGAAAGCAGAAGG - Intergenic
1017800520 6:157891699-157891721 ATGAAGAAAGTGAAAGGAGGCGG + Intronic
1018279570 6:162171226-162171248 ATGGAGAAACTGGAAGGAGGAGG + Intronic
1018409631 6:163530924-163530946 ATAAAGAAAAAGAAAGCAGAGGG - Intronic
1018662361 6:166099955-166099977 ATGAAGGAACTGAAATCTGATGG - Intergenic
1019242111 6:170675915-170675937 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1019327144 7:444074-444096 ATTTAGATACTGAAAGGGGAGGG - Intergenic
1019471056 7:1221223-1221245 ATGCAGACACTGCCAGCAGAAGG + Intergenic
1020490048 7:8770819-8770841 ATGTAGAATTGGAAAGCAGAAGG + Intergenic
1020894233 7:13919207-13919229 ATGAAGAAACTGGAGGCATAAGG + Intronic
1022289458 7:28986994-28987016 ATCTAGAAACTGGAAGGAAAAGG + Intergenic
1022547422 7:31201925-31201947 ATGTAGCATCTGAAAGGAAAGGG + Intergenic
1023458516 7:40367954-40367976 ATCTAGGAAATGAAAGCAGGTGG - Intronic
1024011684 7:45272133-45272155 ATGTAGAAATGGTAAGGAGAAGG - Intergenic
1024431624 7:49294945-49294967 AAGGAGAATCTGAAAGAAGAAGG + Intergenic
1024438243 7:49384152-49384174 TTAAAGAAAATGAAAGCAGAAGG - Intergenic
1025145814 7:56502512-56502534 ATGTAGAAACTGGAAATTGAAGG - Intergenic
1026213962 7:68331807-68331829 ATGCAGAAAGAGAAAGCTGAGGG + Intergenic
1026603585 7:71797108-71797130 ATGTGGAGATTGAAGGCAGAGGG - Intronic
1027998110 7:85452825-85452847 ATGTATAAACTGAATGTAGTTGG - Intergenic
1031602326 7:123725725-123725747 AGGTAGAAACTCAAAGAACAGGG + Intronic
1031753224 7:125604713-125604735 ATGTAGAAATTACAAGGAGATGG + Intergenic
1031909404 7:127499189-127499211 ATGAAGAAACAGAAACCATATGG - Intergenic
1032683440 7:134208772-134208794 TTGGCGAAACTGCAAGCAGATGG + Intronic
1032894228 7:136233141-136233163 GTGTAGAAAAAGAAGGCAGAGGG + Intergenic
1035506007 8:132185-132207 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1036111777 8:5910829-5910851 ATGTAGAAACTGAAAATCAAGGG - Intergenic
1037026166 8:14040715-14040737 AAATAGAAACTGAAAACTGATGG + Intergenic
1037193832 8:16162326-16162348 ATAGAGAAAATGAAATCAGAAGG + Intronic
1037244781 8:16821260-16821282 TTGTAGAAACAGAATGCAGAAGG + Intergenic
1037326695 8:17698975-17698997 ATGTAGAATCTGGAAGGAAAAGG - Intronic
1037410905 8:18596078-18596100 AAGTAGAAATTAAAAGCAGAAGG + Intronic
1037558273 8:20048321-20048343 ATGAAGAAACTAAAGGTAGAAGG - Intergenic
1038239431 8:25794986-25795008 ATATAGAGACTGAAAGCTGTAGG - Intergenic
1038847049 8:31239694-31239716 ATGTTAAACCTTAAAGCAGATGG - Intergenic
1039171708 8:34754908-34754930 ATGAAGAAAGTGAAAACAAAAGG + Intergenic
1039310285 8:36310716-36310738 ATATAGAATCTGAAACCAAATGG - Intergenic
1040430481 8:47336639-47336661 AGGAAGAAACTCAGAGCAGAAGG + Intronic
1040680090 8:49798153-49798175 ACGTAGAAAATGAAATCACAGGG - Intergenic
1042008329 8:64208818-64208840 GTCCAGAAACTGAGAGCAGAGGG + Intergenic
1042044305 8:64631037-64631059 TTGTAGAAAATAGAAGCAGAGGG + Intronic
1042303331 8:67309580-67309602 TTGTATAAACTCAAAACAGATGG - Intronic
1042776709 8:72440240-72440262 CTGTAGATTCTGAAAGCAGGAGG - Intergenic
1044589552 8:93900549-93900571 ATGAAGGAAAGGAAAGCAGAGGG - Intronic
1044762164 8:95531516-95531538 ATGTGACAACTGAAAGCAAAAGG - Intergenic
1045983924 8:108225560-108225582 ATGTAGAATCTGAAACCATGTGG - Intronic
1046190225 8:110785502-110785524 ATGGATATACTGAAAGCAAAAGG - Intergenic
1046428099 8:114082903-114082925 CTGTTGAAATTTAAAGCAGAAGG + Intergenic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1047186081 8:122634650-122634672 GTGTAGAAACTGAAAGCTAAAGG + Intergenic
1047625688 8:126653761-126653783 AGGGAGAAACTGAAAGCAAGAGG - Intergenic
1048200077 8:132365441-132365463 GTGAAGCAACTGGAAGCAGATGG - Intronic
1048256110 8:132906471-132906493 CTGTTAAAACTGAGAGCAGATGG + Intronic
1048528807 8:135228623-135228645 ATGTTGAAACTGAAGGCTCATGG - Intergenic
1048786450 8:138055669-138055691 TTGTAGAAGCTGAAAGGAGGAGG - Intergenic
1049901873 9:176763-176785 ATGTGAAAACTGAAAGGAAAGGG + Intronic
1050099497 9:2103325-2103347 TTGTAAAAACAGACAGCAGACGG + Intronic
1050397515 9:5214851-5214873 ATGTACCAACTCAAATCAGAAGG + Intergenic
1050860134 9:10418510-10418532 ATGGAGAAAATTACAGCAGAAGG - Intronic
1050941023 9:11457968-11457990 ATGTAAGAACTAAAACCAGACGG - Intergenic
1051860517 9:21620243-21620265 AATTAGAAAGTCAAAGCAGAAGG + Intergenic
1051874685 9:21778996-21779018 CTGTAGAAGCTGAGAGCAGAAGG - Intergenic
1052007756 9:23370036-23370058 ATGTACAGACTGAAAGCGAAGGG + Intergenic
1052629977 9:31025326-31025348 ATGAAGAAAGAGAAAGTAGAGGG + Intergenic
1053023416 9:34710944-34710966 ATATAGAAAAGGAAAGCAAAGGG - Intergenic
1053744907 9:41187051-41187073 ATGTGAAAACTGAAAGGAAAGGG + Intronic
1054456714 9:65434990-65435012 ATGTAAAAAATGAAACCACAGGG + Intergenic
1054482364 9:65678168-65678190 ATGTGAAAACTGAAAGGAAAGGG - Intronic
1054683441 9:68244218-68244240 ATGTGAAAACTGAAAGGAAAGGG - Intronic
1055133336 9:72801080-72801102 TTGGAGAAAATCAAAGCAGAGGG - Intronic
1057010865 9:91600219-91600241 ATGAAGAAACTGAACACAGAGGG + Intronic
1057404710 9:94758424-94758446 AGGTAGAAACTGAAATCAATGGG + Intronic
1057415656 9:94860123-94860145 ATGTAGAAGCTGAAACCTGAAGG + Intronic
1059507192 9:114810186-114810208 ATCTAAAAACTGAAAGCATTTGG - Intergenic
1059612034 9:115908861-115908883 ATGTGGAAACAGAAAGGAAAAGG + Intergenic
1060709678 9:125846641-125846663 ATGTAGAAGGAGAAAGCTGATGG - Intronic
1061046967 9:128170755-128170777 AGGTAGAAGGTGGAAGCAGAAGG - Intronic
1061228727 9:129299133-129299155 AAAGAGAAACTGAAAACAGAGGG - Intergenic
1203358554 Un_KI270442v1:189733-189755 TTGTAGAATCTGCAAACAGATGG - Intergenic
1203602302 Un_KI270748v1:25149-25171 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1187412351 X:19062346-19062368 CAGGGGAAACTGAAAGCAGAGGG - Intronic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1188548531 X:31336773-31336795 AAGTAGAAACTATAAGTAGAAGG + Intronic
1189144932 X:38645968-38645990 ATGAAGAACCTGAAAGTATAGGG + Intronic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189795015 X:44637122-44637144 CTGTAGTGACAGAAAGCAGATGG - Intergenic
1189824532 X:44904051-44904073 ATGTAGAAACTGAAAGCAGAAGG + Intronic
1190260341 X:48793323-48793345 ATGAAGACAGGGAAAGCAGAGGG - Intronic
1190450395 X:50573703-50573725 CTGTAGAGACTGAAAACAGATGG - Intergenic
1190483350 X:50899572-50899594 ATGTTGAAACTGAAAGTTGAGGG - Intergenic
1190856782 X:54303606-54303628 ATGTAGAAGCTTAAGACAGATGG + Intronic
1191594502 X:62927729-62927751 ATGAAGAAAGTAGAAGCAGAGGG - Intergenic
1192439461 X:71164102-71164124 ATGAAGACAATGAAGGCAGAGGG - Intronic
1192698090 X:73439275-73439297 ATGTATAAACTTAAAGTAAATGG + Intergenic
1192889430 X:75373222-75373244 ATGTGGAAAATGCAAGTAGAAGG - Intronic
1193365041 X:80622400-80622422 ATGGACAAACTGAAAGAAGTAGG - Intergenic
1194493079 X:94575671-94575693 AGGTTTTAACTGAAAGCAGAAGG + Intergenic
1194530401 X:95041003-95041025 ATGTAGAAAATCAAGACAGAAGG + Intergenic
1195060321 X:101187964-101187986 ATGTAGAAAAGGAAATCAAAGGG - Intergenic
1195152410 X:102085394-102085416 ATGTAGCATCAGAAAGTAGAAGG - Intergenic
1195177830 X:102327838-102327860 ATGTAGAGAGAGGAAGCAGAGGG - Intergenic
1195181034 X:102359255-102359277 ATGTAGAGAGAGGAAGCAGAGGG + Intergenic
1196290767 X:113938181-113938203 ATGAAGAAACTGTAAGTAGTTGG - Intergenic
1196653659 X:118194610-118194632 ATGAAGAAAAGCAAAGCAGACGG + Intergenic
1196664168 X:118298826-118298848 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
1196917907 X:120557799-120557821 ATGGAGAAACTAAAATTAGAAGG + Intronic
1197464669 X:126788480-126788502 ATCAAGAAGCTAAAAGCAGATGG - Intergenic
1197756889 X:130001911-130001933 ATCAAGAAATTGAAGGCAGAGGG + Intronic
1198581646 X:138071969-138071991 ATCTGGAAACTGAAAGGTGAGGG + Intergenic
1198788824 X:140319949-140319971 ATGTGGAAACTGAAAGTCAAAGG - Intergenic
1198885951 X:141337423-141337445 ATATAGAAACAGAGAGTAGAAGG - Intergenic
1199198393 X:145059004-145059026 ACGAAGAAACTGAAAGTAGGTGG + Intergenic
1199810550 X:151344551-151344573 ATGTAAAACCTGACAGCAGGAGG - Intergenic
1200826910 Y:7655743-7655765 ATGTAAAAACTGAAAAGAGAAGG - Intergenic
1200985630 Y:9301603-9301625 ATGTAAAAACTGAAAAGAGAAGG - Intergenic
1201181613 Y:11353219-11353241 ATATAGAAACTGAAAAAAAAAGG + Intergenic
1202106988 Y:21382218-21382240 ATGTAAAAACCGAAAAGAGAAGG - Intergenic
1202124908 Y:21559095-21559117 ATGTAAAAACTGAAAAGAGAAGG + Intergenic
1202154100 Y:21870285-21870307 ATGTAAAAACTGAAAAGAGAAGG - Intergenic