ID: 1189834311

View in Genome Browser
Species Human (GRCh38)
Location X:45005071-45005093
Sequence TCTTAGGTATGGAGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 3, 1: 1, 2: 11, 3: 29, 4: 202}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189834290_1189834311 24 Left 1189834290 X:45005024-45005046 CCCCCCCCTCCTTATGGTACCTC 0: 1
1: 1
2: 3
3: 22
4: 219
Right 1189834311 X:45005071-45005093 TCTTAGGTATGGAGGGAAATGGG 0: 3
1: 1
2: 11
3: 29
4: 202
1189834296_1189834311 18 Left 1189834296 X:45005030-45005052 CCTCCTTATGGTACCTCTTTCAA 0: 1
1: 6
2: 8
3: 15
4: 99
Right 1189834311 X:45005071-45005093 TCTTAGGTATGGAGGGAAATGGG 0: 3
1: 1
2: 11
3: 29
4: 202
1189834297_1189834311 15 Left 1189834297 X:45005033-45005055 CCTTATGGTACCTCTTTCAAAGG 0: 1
1: 10
2: 7
3: 10
4: 117
Right 1189834311 X:45005071-45005093 TCTTAGGTATGGAGGGAAATGGG 0: 3
1: 1
2: 11
3: 29
4: 202
1189834295_1189834311 19 Left 1189834295 X:45005029-45005051 CCCTCCTTATGGTACCTCTTTCA 0: 1
1: 6
2: 6
3: 14
4: 173
Right 1189834311 X:45005071-45005093 TCTTAGGTATGGAGGGAAATGGG 0: 3
1: 1
2: 11
3: 29
4: 202
1189834302_1189834311 5 Left 1189834302 X:45005043-45005065 CCTCTTTCAAAGGGAAGAGGGTT 0: 2
1: 8
2: 4
3: 31
4: 206
Right 1189834311 X:45005071-45005093 TCTTAGGTATGGAGGGAAATGGG 0: 3
1: 1
2: 11
3: 29
4: 202
1189834293_1189834311 21 Left 1189834293 X:45005027-45005049 CCCCCTCCTTATGGTACCTCTTT 0: 1
1: 5
2: 10
3: 26
4: 236
Right 1189834311 X:45005071-45005093 TCTTAGGTATGGAGGGAAATGGG 0: 3
1: 1
2: 11
3: 29
4: 202
1189834291_1189834311 23 Left 1189834291 X:45005025-45005047 CCCCCCCTCCTTATGGTACCTCT 0: 1
1: 1
2: 5
3: 25
4: 169
Right 1189834311 X:45005071-45005093 TCTTAGGTATGGAGGGAAATGGG 0: 3
1: 1
2: 11
3: 29
4: 202
1189834294_1189834311 20 Left 1189834294 X:45005028-45005050 CCCCTCCTTATGGTACCTCTTTC 0: 1
1: 5
2: 6
3: 23
4: 180
Right 1189834311 X:45005071-45005093 TCTTAGGTATGGAGGGAAATGGG 0: 3
1: 1
2: 11
3: 29
4: 202
1189834292_1189834311 22 Left 1189834292 X:45005026-45005048 CCCCCCTCCTTATGGTACCTCTT 0: 1
1: 3
2: 4
3: 12
4: 165
Right 1189834311 X:45005071-45005093 TCTTAGGTATGGAGGGAAATGGG 0: 3
1: 1
2: 11
3: 29
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189834311 Original CRISPR TCTTAGGTATGGAGGGAAAT GGG Intronic
901946993 1:12712134-12712156 CCTTAGGTATGGAGGGAATTGGG + Intergenic
902811917 1:18892775-18892797 TTTTAGGGAGGGAGGGAAACTGG - Intronic
904395506 1:30218813-30218835 TGCTAGGTAGGGAGGGAGATAGG + Intergenic
904683147 1:32242554-32242576 TCTTATGTATGGGAGGAAGTAGG - Intergenic
906343779 1:45002926-45002948 TCTCTGGTATGGAGGGAGAGGGG + Exonic
908995804 1:70152323-70152345 TCCTAGGTATGTATGGAAACTGG - Intronic
909068656 1:70965570-70965592 TATTAAGTATGGAGGGAATGGGG - Intronic
909207136 1:72773195-72773217 TCATAGGTATGGAGGAAATGTGG + Intergenic
909759517 1:79270901-79270923 TCTCAGGCAAGGAGGGAAGTTGG + Intergenic
911460396 1:98181991-98182013 CCTTTGGTATGGAGGAAAATGGG - Intergenic
913530177 1:119728396-119728418 TCTGAAATATGGAGGGAAACTGG - Intronic
914892448 1:151638347-151638369 TTTGAGATATGGAGAGAAATTGG + Intronic
916125033 1:161562135-161562157 TCTGAGGAAGGGAGTGAAATTGG - Intergenic
916134925 1:161643481-161643503 TCTGAGGAAGGGAGTGAAATTGG - Intronic
916503961 1:165410892-165410914 TCTTGGGTAGGGCTGGAAATGGG - Intronic
917234355 1:172874237-172874259 TCTTAGGAAGGGAAGGAAAAGGG + Intergenic
917312255 1:173690126-173690148 TCTTAGGTACAGAAGGAACTGGG + Intergenic
917407004 1:174717954-174717976 TCTTGGGTAGGGAGGCAGATGGG + Intronic
917653786 1:177105562-177105584 TGTTAGTTATGGTGGGAAAGAGG - Intronic
923779425 1:237009064-237009086 TCATAGGGATGCAGGAAAATGGG - Intergenic
924301886 1:242648029-242648051 TAGTAGGTATGGACAGAAATGGG + Intergenic
1062786755 10:271317-271339 TCTTAGGTACGGAAGGGATTGGG - Intergenic
1063330642 10:5155616-5155638 TCTGTAGTATGCAGGGAAATGGG - Intergenic
1065623474 10:27607365-27607387 TCTTAGTTATTGAGGGAATCTGG + Intergenic
1065920469 10:30388280-30388302 TGTTATGTATTGGGGGAAATGGG - Intergenic
1066119285 10:32268221-32268243 TTTTTGGTGTGGAAGGAAATGGG + Intronic
1066391203 10:34978591-34978613 TTGTAGGGATGGAGGGACATGGG + Intergenic
1067108381 10:43381057-43381079 GCCTAAGTAGGGAGGGAAATGGG - Intergenic
1069263254 10:66427164-66427186 TCTCAGTTATGGAGGGATATTGG - Intronic
1069587120 10:69614604-69614626 TCATAGGAAGGGAGAGAAATAGG - Intergenic
1070005667 10:72421866-72421888 TCATAGGAATGGAGGGAGTTTGG - Intronic
1070429685 10:76324783-76324805 TATTAGTGATGGAGAGAAATTGG + Intronic
1071283555 10:84124539-84124561 TCTTAGGTACGGAGGGGAATGGG + Intergenic
1071735464 10:88294048-88294070 TCTAAGGGTTGGAGGAAAATAGG + Intronic
1071870007 10:89783422-89783444 TATTAGGTATGGAAAGAAACAGG + Intergenic
1073808600 10:107127532-107127554 TCTTAGGACAGCAGGGAAATGGG + Intronic
1074374379 10:112927217-112927239 TCTTGTGTCTGGAGGGCAATTGG + Intergenic
1075182209 10:120221796-120221818 TATTAGGTTTGGAAGGAAATGGG + Intergenic
1078131742 11:8619334-8619356 TCCTGGGGATGCAGGGAAATAGG + Intronic
1078491802 11:11776344-11776366 TGTTTGGTATGGTGGCAAATAGG + Intergenic
1079388848 11:20003573-20003595 ACTTAGAGATGGAGGGAAGTGGG - Intronic
1080391911 11:31855872-31855894 TAGCAGGTAGGGAGGGAAATAGG - Intronic
1082738748 11:56886948-56886970 GCTTAGGAATGGAGGGAGTTGGG + Intergenic
1083375313 11:62215588-62215610 CCTTAGGTGTGGAGGGAAATGGG - Intergenic
1087144910 11:94801482-94801504 TCTTAGGTAGGGATGGTAAGTGG + Intronic
1089410055 11:118233400-118233422 TCTTAGGTAAGCAGGAAAGTGGG + Intronic
1090324163 11:125870481-125870503 CCTTAGGTGTGGAGGGAAATGGG + Intergenic
1091971574 12:4791898-4791920 GCTTAGGGCTGGTGGGAAATGGG + Intronic
1092258693 12:6941018-6941040 TCTTTGGTAAGGATGGAAGTTGG + Exonic
1092694830 12:11159620-11159642 TCTTAGGAATGCTGGGAAACGGG - Intronic
1095536811 12:43258796-43258818 TCTCAGCTATAAAGGGAAATAGG + Intergenic
1095915241 12:47471543-47471565 ACTTAGGCATGGAAAGAAATTGG + Intergenic
1096869483 12:54584320-54584342 TCTGAGGGAAGGTGGGAAATGGG + Exonic
1097420591 12:59373635-59373657 TCTAAGGTATGGAGTGAAAGGGG + Intergenic
1097829123 12:64205591-64205613 TCTAAGGAAAGGAGGGAAAAAGG + Intronic
1099176669 12:79430043-79430065 GCTTAGGTAGAGAGGGAAAGAGG - Intronic
1100326337 12:93543280-93543302 TCTTAGATCTGGAGGGTGATTGG + Intergenic
1100974739 12:100110932-100110954 TCTTGGGCATGGAGGAATATGGG + Intronic
1102152207 12:110696599-110696621 TCTTAGGGCTGGAGGGAGACAGG - Intronic
1102605762 12:114066146-114066168 CCTTAGGTACAGAGGGAAATGGG - Intergenic
1103110293 12:118271344-118271366 TCTTAGGAATGGAGGGAATGGGG - Intronic
1104826680 12:131715332-131715354 TCTCAGTTGTGGAGGGATATGGG - Intronic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1106776492 13:33015449-33015471 TCTGAGCTGTGGAGGGAAAGGGG - Intergenic
1107658167 13:42613114-42613136 TCTAAGGAGTGGAGGTAAATAGG - Intergenic
1109582204 13:64355474-64355496 TGTAATGTATGGAGGGAAACCGG - Intergenic
1110198638 13:72821177-72821199 TGTTAGGAATGGTGAGAAATGGG + Intronic
1112265093 13:97916314-97916336 TTATGTGTATGGAGGGAAATGGG + Intergenic
1113022594 13:105904818-105904840 TGTCAGGTAAGGAGGGAGATGGG + Intergenic
1113524893 13:110967055-110967077 TCTTAGGTACAGAGAGAAATGGG - Intergenic
1114009216 14:18349126-18349148 CCTTAGGTGTGGAGAGAAAAGGG - Intergenic
1114130832 14:19789835-19789857 TTTGAGGTATGGGGTGAAATGGG + Intronic
1115568930 14:34649037-34649059 CTTTAGGTTTGGAGGGAATTGGG + Intergenic
1116183752 14:41569570-41569592 TTTTGGGGATGCAGGGAAATAGG + Intergenic
1116411340 14:44627094-44627116 GCTGAGGTCTGGAAGGAAATGGG - Intergenic
1116937094 14:50751895-50751917 TCTTAAAAATGGAGGGACATGGG - Intronic
1117012777 14:51487858-51487880 TGATAGGTATAGAGGGAAGTAGG + Intergenic
1117594654 14:57314040-57314062 TGATAGGTTTGGGGGGAAATTGG - Intergenic
1120498644 14:85266689-85266711 ACTTAGGTATGGTGAGGAATTGG - Intergenic
1122254265 14:100465066-100465088 TCCTAGGAAGGGAGGGAAAGGGG - Intronic
1123392409 15:19889729-19889751 CCTTAGGTGTGGAGAGAAAAGGG - Intergenic
1124186707 15:27536465-27536487 TTTTATGAATGGATGGAAATAGG + Exonic
1124445012 15:29722670-29722692 TCTAAGGTCTGGAGGACAATGGG - Intronic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1125539905 15:40464284-40464306 TGTTAGGCATGGAGGGAGAAGGG - Intronic
1125797889 15:42417359-42417381 TCCTAGGAATGAAGGGAAAAGGG + Exonic
1125841503 15:42805608-42805630 TAATAGAGATGGAGGGAAATGGG - Intronic
1128464783 15:67901108-67901130 TCTTATGTGTGGTGGGAGATAGG + Intergenic
1133618356 16:7501331-7501353 TCTTATGAATGGAAGGAAAGAGG - Intronic
1133910312 16:10059955-10059977 TCCTAGGGATGGAGGAAAAGGGG + Intronic
1134817570 16:17218677-17218699 GCTTAGATTTGGAGGGAGATGGG - Intronic
1140666556 16:77233555-77233577 TCTCGGGTATGGATGAAAATAGG + Intergenic
1141171558 16:81694855-81694877 CCTCAGGCATGGAGGGAAAAAGG + Intronic
1142473110 17:174065-174087 TCTTGGGTCTGCAGGGAAATTGG + Intronic
1143801370 17:9384929-9384951 TTTTTGGTATGGAGAGAAAAGGG - Intronic
1146115922 17:30138810-30138832 ACTTAGGGATGTAGAGAAATTGG - Intronic
1149512795 17:57256735-57256757 GCTCAGATATGGAGGCAAATGGG + Exonic
1150937858 17:69657006-69657028 TATTAGGAATAGAGAGAAATAGG - Intergenic
1151212551 17:72555346-72555368 TCTTGGGTATGGTGAGAACTAGG - Intergenic
1153106749 18:1536802-1536824 TCATAGGTATGAAGGGAATATGG - Intergenic
1153826684 18:8881737-8881759 TCTTAGGTACCAAGGGAAATGGG + Intergenic
1154977375 18:21473043-21473065 ACTTGGGTCTGGAGGAAAATGGG + Exonic
1155075809 18:22353618-22353640 TCTTTTGTATGGTGGGAGATAGG + Intergenic
1156988572 18:43378948-43378970 TATTAGTTATTTAGGGAAATTGG - Intergenic
1158987627 18:62834875-62834897 TCTTAGGGATGGAGAGGAGTGGG - Intronic
1159645897 18:70917223-70917245 GCTTAGGTATAGAGGAAAGTAGG + Intergenic
1159715004 18:71810690-71810712 TCTCAGATATGGAGCAAAATGGG + Intergenic
1159804708 18:72941937-72941959 TCTAAGTTTTGGAGAGAAATTGG + Intergenic
1162839026 19:13341977-13341999 TCTGAGCTATGCAGGGAACTTGG - Intronic
1162859199 19:13492865-13492887 GCTTAGAGATGGAGGGGAATGGG - Intronic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
926038074 2:9650454-9650476 TGTTAGGTTTGGAGGGAACTTGG - Intergenic
926453305 2:13034117-13034139 TATTATGGATGGAGGGAAAACGG + Intergenic
927450407 2:23204887-23204909 TCTTAGGAAGGAAGGGAATTGGG + Intergenic
927603458 2:24464537-24464559 TCTTAGCAATGGAGGAAAAGTGG - Intergenic
927948991 2:27154897-27154919 TCCTGGGGATGAAGGGAAATTGG + Exonic
928059990 2:28102251-28102273 TCTCTGGTATTGAGGGAAAAAGG - Intronic
929166782 2:38890379-38890401 GATTAGGGATGGAGGGAGATTGG + Intronic
929524281 2:42685845-42685867 TTATAAGTATGGAGGGAAAGAGG - Intronic
930188701 2:48436133-48436155 GCTTAGGTATGCAGAGAAAATGG + Intergenic
930898489 2:56474291-56474313 TCTTAGGGATGAGGGGAACTTGG + Intergenic
931836998 2:66109478-66109500 TCTTTGGACTGGAGGGAAAATGG + Intergenic
932088879 2:68787226-68787248 TCTTAGGTTTGAAGTGAAAATGG + Intronic
933390085 2:81656903-81656925 TCTTAGGTACAGAGGGAAATGGG + Intergenic
934546207 2:95218820-95218842 GCATAGGTGTGGAGAGAAATTGG + Intronic
935047916 2:99498480-99498502 TCTTAGGTATGGAGGGAAATGGG - Intergenic
938527363 2:132146227-132146249 CCTTAGGTGTGGAGGGAAAAGGG + Intergenic
939015008 2:136892393-136892415 TGTTATGTAAGAAGGGAAATTGG + Intronic
942457672 2:176149202-176149224 TCTTTGGCATTCAGGGAAATTGG + Intergenic
942535477 2:176958501-176958523 TCTGGGGCATGAAGGGAAATGGG - Intergenic
946501736 2:220255944-220255966 TCTGAGGTAGGGAATGAAATAGG + Intergenic
947238567 2:227969918-227969940 TATTGGGTATTGGGGGAAATGGG + Intergenic
947556604 2:231098918-231098940 TCTTAGGTACAGAGGGAAATGGG + Intronic
1168823554 20:793488-793510 TCTTAGGTACGGAGGGAAATAGG - Intergenic
1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG + Intronic
1169526748 20:6436551-6436573 TCTTATGTATGGTGTGAGATAGG + Intergenic
1169985021 20:11434545-11434567 CCTTAGGTCAAGAGGGAAATGGG - Intergenic
1172123577 20:32612450-32612472 TCTTTGGAAGGGAGGGAAATTGG - Intergenic
1173082579 20:39882986-39883008 TCTGAGGCATGAAGGCAAATAGG - Intergenic
1175966284 20:62661662-62661684 TCTGAGGGAGGGAGGGAGATGGG - Intronic
1178381991 21:32117869-32117891 GCTCAGGTGTGGAGGGAAATGGG - Intergenic
1180433717 22:15279936-15279958 CCTTAGGTGTGGAGAGAAAAGGG - Intergenic
1180516273 22:16147845-16147867 TCTTAGGTGTGGAGAGAAAAGGG - Intergenic
1180752856 22:18137092-18137114 GCTCAGAGATGGAGGGAAATAGG + Intronic
1184065092 22:42114050-42114072 CCATAGATGTGGAGGGAAATGGG + Intergenic
1184074490 22:42167544-42167566 ACTGAGGCATGAAGGGAAATAGG - Intronic
1185007662 22:48291927-48291949 TGATAGGAATGGAGGTAAATTGG - Intergenic
950846746 3:16022557-16022579 TGTTAGGTACAGAGGGAAATGGG + Intergenic
951728524 3:25784926-25784948 TCTAAGGTATGGAAGGAGACTGG - Intronic
954908509 3:54083688-54083710 TCTTAGAAATGGAGAGAAATAGG + Intergenic
955311231 3:57888804-57888826 TTTTAGGAATGGAGTGAAGTAGG + Intronic
955797495 3:62653031-62653053 TGTTAGTTATGCAGGGAGATAGG - Intronic
956555932 3:70522445-70522467 TCTAATGCATGGAGGGAAAATGG - Intergenic
957140052 3:76342526-76342548 TCTTAGCTCTGGGAGGAAATCGG + Intronic
959043690 3:101448065-101448087 TTTTGGGTATGGAATGAAATAGG - Intronic
960349994 3:116580479-116580501 TCCTAGATATTGAAGGAAATTGG + Intronic
961582244 3:127892357-127892379 CCTTAGGTACGGAGGGAAATGGG - Intergenic
965470598 3:169085604-169085626 TGTCAAGCATGGAGGGAAATTGG - Intronic
966206238 3:177409490-177409512 ACTCAGGTTTGGAGGAAAATGGG - Intergenic
967792752 3:193566539-193566561 TTTTAGGGATAGAGGGAAAGGGG - Intronic
968054409 3:195680558-195680580 ACTTAGGTATGCTGGGAACTGGG - Intergenic
968101482 3:195968600-195968622 ACTTAGGTATGCTGGGAACTGGG + Intergenic
970423165 4:15923872-15923894 TTTTAGGTATGGAGGCAACATGG - Intergenic
973160751 4:47013236-47013258 TCTTAAGTATGTAGAGAGATGGG - Intronic
975641001 4:76500256-76500278 TCATAATAATGGAGGGAAATGGG + Intronic
976126370 4:81837574-81837596 TCTTAAGGATGAAGGGGAATTGG - Intronic
976313341 4:83634237-83634259 TTTTAGATATGGAGGCACATGGG + Intergenic
977409972 4:96650694-96650716 TATGAGGTATGGAGGAAAACTGG - Intergenic
978313882 4:107414875-107414897 TCTTAGGTATGGAGGGAAATGGG - Intergenic
983288259 4:165767066-165767088 TCTTCGACATGGGGGGAAATGGG + Intergenic
983557634 4:169072581-169072603 CCTTAGCTATGGAGGGAGCTGGG - Intergenic
985735406 5:1577278-1577300 ACTTAGGTATGCTGGGAAGTAGG + Intergenic
985895087 5:2744584-2744606 TCTGAGGTCTGGAGGGTAAAAGG - Intergenic
986862482 5:11943581-11943603 TTGGAGGTATGGAGGGCAATGGG + Intergenic
988705197 5:33719155-33719177 TCTTAGGTAGGAAGGTAGATGGG + Intronic
988721819 5:33886753-33886775 CCATAGGTGTGGATGGAAATCGG + Intronic
989376287 5:40765423-40765445 TCTTAAAACTGGAGGGAAATTGG - Intronic
989438066 5:41437814-41437836 TCTTTGGTATGGGAAGAAATTGG + Intronic
989615669 5:43334855-43334877 TCTTAGGTACAGAGGGAAATGGG + Intergenic
990010776 5:50994914-50994936 TGTTAGGTATGGAGGGAATGGGG + Intergenic
993693057 5:91026564-91026586 TTTCAGTTATGGAGGGAAAGTGG + Intronic
993762845 5:91818277-91818299 TTTTAGGTATGGAGGTAAGGAGG + Intergenic
993845383 5:92935984-92936006 TCCTGGGTATGGAGGGAGGTAGG + Intergenic
995457916 5:112371472-112371494 TCTGAGGAACGGAGGGAAGTGGG - Intronic
995625140 5:114068332-114068354 TCTAAGGTATGGAAGAAATTTGG + Intergenic
998886250 5:146697436-146697458 TGTTAAGTATGGAGGGAGATAGG + Intronic
999868825 5:155729147-155729169 GCTTAGAGATGGAGGGAACTGGG - Intergenic
1000358506 5:160424503-160424525 TCTTAGGTCAGGAGGGGAATAGG + Intronic
1001184124 5:169551198-169551220 CCTTAGGCATGGAGTGAAAAGGG - Intergenic
1001439585 5:171731374-171731396 TCTTGTGTGTGGTGGGAAATAGG - Intergenic
1004632414 6:17434633-17434655 TCAGGGGTATGGAGGGAAATGGG - Intronic
1010551282 6:77225102-77225124 TTATAGCTATAGAGGGAAATGGG - Intergenic
1011188796 6:84708563-84708585 TCATATGTAGGGAGGGATATGGG + Intronic
1011351452 6:86428025-86428047 TGTTAGCTATTGAAGGAAATTGG - Intergenic
1018798813 6:167207283-167207305 TCATATGTGTGGAAGGAAATGGG - Intergenic
1018896700 6:168024481-168024503 GGCTAGGTAAGGAGGGAAATGGG + Intronic
1019826852 7:3291713-3291735 TGTGAGGTAAGGAGGGAATTGGG - Intergenic
1021534726 7:21690305-21690327 TGAAAGGTATGGAGGGAAAGAGG + Intronic
1023155101 7:37242487-37242509 TGCTAGGTATGTAAGGAAATAGG - Intronic
1023798312 7:43811883-43811905 CCTTAGATACGGAGGGAAATGGG - Intergenic
1023798798 7:43815189-43815211 CCTTAGGTACAGAGGGAAATGGG - Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1027414499 7:77960648-77960670 TGTTAGTTATGCAGGAAAATTGG + Intergenic
1027702811 7:81488949-81488971 TCTGAGGTATGTTGGGAAATTGG + Intergenic
1028018650 7:85744517-85744539 CCTTAGGTGTGGAGGGAAGTGGG + Intergenic
1028474078 7:91234721-91234743 TTTTATTAATGGAGGGAAATTGG - Intergenic
1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG + Intronic
1031896787 7:127359174-127359196 TCCTAGGTATGCAGGCAAACAGG - Intronic
1032839887 7:135705421-135705443 TCCTAGGTATGGAGAGGAAATGG + Intronic
1033098146 7:138448601-138448623 TCTTAGGTACAGAGGGAAATGGG + Intergenic
1033157011 7:138965896-138965918 ACTCAGGTGTGGAGGGAAGTGGG - Intronic
1037672387 8:21026323-21026345 TCTTAGAGATGGAGAGAAAATGG - Intergenic
1037874367 8:22533158-22533180 TTTTCTGTATGGAGGGAAGTAGG - Intronic
1037907907 8:22726271-22726293 GCTTAGGTATGGAGGGCAGATGG + Intronic
1039689767 8:39851220-39851242 CCTTAGATGTGGAGGGAAATGGG + Intergenic
1042577680 8:70238912-70238934 TTGCAGATATGGAGGGAAATGGG - Intronic
1043577149 8:81671269-81671291 TATTATGTATGCAGGCAAATTGG - Intronic
1043888369 8:85628870-85628892 TCTTAGAAATGGAACGAAATTGG - Intergenic
1044568337 8:93689826-93689848 TGGGAGGTCTGGAGGGAAATAGG + Intergenic
1045612782 8:103866573-103866595 GCTTAGGTATGTAGCAAAATTGG - Intronic
1045652617 8:104355225-104355247 TGTTGAGTTTGGAGGGAAATGGG + Intronic
1046376178 8:113384080-113384102 TTTTAAGTATGGTGGGAATTTGG - Intronic
1048407555 8:134138745-134138767 TCTTTACTATGGAAGGAAATGGG - Intergenic
1050522769 9:6518759-6518781 TCTTGGGTACGGAGGGGAATGGG - Intergenic
1051361297 9:16283879-16283901 TCATAGGGATGCAGGGAATTTGG - Intergenic
1052303055 9:26974939-26974961 CCTTAGGTGTGGAGGGAAATGGG + Intronic
1054859241 9:69932291-69932313 CCTTAGATGTAGAGGGAAATGGG + Intergenic
1055824920 9:80312215-80312237 TCTAAGGTATGCAGAGAAAAGGG + Intergenic
1056406340 9:86279427-86279449 TTCTAGATATGTAGGGAAATAGG + Intronic
1056551270 9:87654868-87654890 ATTTAGGTATGGAGTGAAACTGG - Intronic
1056600373 9:88042401-88042423 TCTTAGGTGTGGAGAGAAATGGG + Intergenic
1060448057 9:123710107-123710129 TCTTAGGTATGTTGGAAATTTGG - Intronic
1060620033 9:125056506-125056528 TCATTGGTATGGATGAAAATTGG + Intronic
1060689977 9:125649169-125649191 TTGTAGGTATGGAGGGGACTAGG - Intronic
1186955346 X:14675592-14675614 TATTAGATATGGAGAGAAAATGG + Intronic
1188598234 X:31927564-31927586 TTTTATGTATGGAGGGAAGGTGG - Intronic
1188603304 X:31996122-31996144 ACATAGGCATGGAGAGAAATTGG + Intronic
1189406321 X:40728319-40728341 TCTGGGGTATGAAGGGAAACTGG - Intronic
1189834311 X:45005071-45005093 TCTTAGGTATGGAGGGAAATGGG + Intronic
1193177155 X:78408030-78408052 TGTGAGGTATGGAGGGAACTAGG - Intergenic
1196916790 X:120544864-120544886 ACTTAGTTATGGAGGAAAATAGG - Intronic
1197254318 X:124246660-124246682 TGTTGGGGATGTAGGGAAATGGG - Intronic
1197575662 X:128208055-128208077 TCTTAGGTCTTGAGGAAAACCGG - Intergenic
1198310366 X:135423000-135423022 CCTGAGGAATGGAGGGTAATGGG + Intergenic
1198417947 X:136439767-136439789 TCTTAGGAATACAGGAAAATTGG - Intergenic
1199637451 X:149826864-149826886 CCTTAGGTACAGAGGGAAATGGG - Intergenic