ID: 1189835196

View in Genome Browser
Species Human (GRCh38)
Location X:45013232-45013254
Sequence CCTCTCAATCTTAAAACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189835196 Original CRISPR CCTCTCAATCTTAAAACCTG GGG (reversed) Intronic
901774940 1:11554038-11554060 CTTCTCAATTGTAAAACCAGGGG + Intergenic
904197605 1:28797494-28797516 TCTTTCAATCTTAAAACCTCCGG - Intergenic
906068720 1:43001899-43001921 CCTCTTAATATTATCACCTGGGG + Intergenic
907633199 1:56105855-56105877 CCTCTCAACCTCAACAGCTGTGG - Intergenic
910493255 1:87796452-87796474 CCCCTTAATCTTTAAACCTCAGG - Intergenic
913171322 1:116234796-116234818 AATCTCATTCTTAAAACCTATGG + Intergenic
917348339 1:174051927-174051949 TCTCTTAAGCTTAAAATCTGTGG + Intergenic
918260508 1:182791193-182791215 CCTCTCATTTTAAAAACCAGGGG - Intronic
919079503 1:192852788-192852810 TCTCTCAGTATTTAAACCTGTGG + Intergenic
922536847 1:226387334-226387356 CCTCTCCATTTTAAAGGCTGAGG + Intronic
922564450 1:226592519-226592541 CCTCTTATTCTTAAAACCACTGG - Intronic
923169488 1:231400747-231400769 CCTCTCAATTTTAAAAGGTTAGG - Intronic
923191950 1:231627641-231627663 CTTCTCACTCTTAAAATGTGAGG + Intronic
1063263822 10:4422907-4422929 CCTCTCCATCAAAAAGCCTGAGG - Intergenic
1066089331 10:32002502-32002524 CCTTACAATTTCAAAACCTGAGG + Intergenic
1070237391 10:74643147-74643169 CCTTTCAATTTTAAGACCTTAGG - Intronic
1077038171 11:505293-505315 CCTCCTAATCTCCAAACCTGTGG + Intronic
1077768298 11:5186398-5186420 CCTCTTAAGCTGAAAACCTTGGG - Intergenic
1077790754 11:5437386-5437408 CCTCTCTGGCTTAAATCCTGGGG - Intronic
1079514004 11:21245360-21245382 CATCTCATTCTTATAACCTGAGG - Intronic
1080528697 11:33152650-33152672 CTTCACATTCTTAAAAACTGAGG + Intronic
1082728456 11:56766165-56766187 CATTTCAATCATAAAACCTAAGG + Intergenic
1088043624 11:105420104-105420126 CCACTAAATCTTAAAAGTTGGGG + Intergenic
1096028879 12:48393839-48393861 CCTCTCAAACTTATTACATGAGG - Intergenic
1096890437 12:54764944-54764966 CCTCTAAACCTTAAAAACAGAGG - Intergenic
1102529697 12:113537042-113537064 CCCATCAATCTTATCACCTGTGG - Intergenic
1104142060 12:125997417-125997439 CTTCTCAGTCTTAATTCCTGAGG + Intergenic
1107570363 13:41650984-41651006 CTTCTCATTCTTACAACCAGAGG + Intronic
1108407628 13:50121623-50121645 GCTCTCAGTCTTAGGACCTGTGG + Intronic
1115616951 14:35104682-35104704 CCTAGCAATCTTAAACCCAGAGG + Intronic
1117027063 14:51631809-51631831 ACTCTCACTCTTAGACCCTGTGG - Intronic
1119698128 14:76730410-76730432 CCTCCCAGTCTTAAAACATGAGG - Intergenic
1121781387 14:96624573-96624595 CTTCTCAATCTTCAACCCTAGGG + Intergenic
1121795509 14:96732198-96732220 CCTCAGAGTCTTAAAATCTGAGG - Intergenic
1131276047 15:90982185-90982207 CCCCCCAATTTTAAAACTTGTGG + Intronic
1133470147 16:6067102-6067124 ACACTCAATCTTATAACATGAGG - Intronic
1136171464 16:28492202-28492224 CCGCTCCAGTTTAAAACCTGCGG - Exonic
1136595798 16:31249069-31249091 CCTCTCAATCTCTCACCCTGGGG - Intergenic
1144030946 17:11322936-11322958 TCTCTCAAACTTCAAACCTTTGG - Intronic
1148460353 17:47836167-47836189 CCTCTCAGCCTGCAAACCTGGGG + Intronic
1149308480 17:55371922-55371944 ACTCTCATTTTTAAAACCTTTGG - Intergenic
1150534480 17:66021555-66021577 CCTCTCACTCTTCAGACCTGAGG - Intronic
1158993863 18:62897160-62897182 CATCTCATTCTTACTACCTGAGG - Intronic
1159529178 18:69633909-69633931 CCTCTAAATCCTAAAACCATTGG - Intronic
1159631877 18:70758589-70758611 CCTTTCAAACTTAAAAACTTAGG - Intergenic
1161014253 19:1975700-1975722 GCTCTAAAACTTCAAACCTGGGG + Intronic
1165885350 19:39074254-39074276 CCTCTCAATCTCAAATTCTAGGG + Intergenic
926648458 2:15315669-15315691 CCTTTCCATCTCAAATCCTGTGG - Intronic
926835218 2:17011766-17011788 ACTCAGAATCTTAAAAGCTGAGG + Intergenic
927489998 2:23514983-23515005 CCTCTCAAGCCTAAAAACTAGGG + Intronic
928961849 2:36934421-36934443 TGTCTTAATCTTAAAATCTGAGG + Intronic
929365275 2:41147053-41147075 CCTCTCATTCTCAAAAACTTGGG - Intergenic
935378564 2:102425313-102425335 ACTCTCATTCTTAAAATTTGGGG - Intronic
937415007 2:121707564-121707586 CCTCTCATTTTAACAACCTGGGG - Intergenic
938955162 2:136290648-136290670 CCTCTTGATCTTCAGACCTGTGG + Intergenic
939473799 2:142659382-142659404 CCCCTCACTCTTTAAAGCTGTGG + Intergenic
939790467 2:146567939-146567961 TTTCTCAATCTCAAAACTTGAGG + Intergenic
941665350 2:168239400-168239422 CCTCTCAGTCCTAAGACCTCAGG + Intronic
941892236 2:170594565-170594587 CCTCTCTCCCTTGAAACCTGTGG - Intronic
943551438 2:189345205-189345227 CCTCTCAGTCTTAAAACTTGAGG - Intergenic
943772002 2:191728078-191728100 CCTCACAATCCTTAAACCTGAGG + Intergenic
944638509 2:201697733-201697755 CCTATCAAACTTTAAAACTGGGG + Intronic
946388151 2:219398723-219398745 CTTCTTAATCTTTAAACATGAGG + Intronic
1173588205 20:44201292-44201314 CCTCTCAATACCAAAATCTGAGG - Intronic
1175960240 20:62632273-62632295 TCACTCAATCTTAAAACCAAAGG - Intergenic
1178757190 21:35363143-35363165 CCTCACAATCCTACAGCCTGGGG - Intronic
1180818098 22:18805743-18805765 TCTCTCAGACTGAAAACCTGGGG - Intergenic
1183747039 22:39697986-39698008 CCTTACATCCTTAAAACCTGTGG - Intergenic
1184355806 22:43978828-43978850 CTTATCTACCTTAAAACCTGGGG + Intronic
950154434 3:10711034-10711056 CCTGACACTCTTAAAACCTGAGG + Intergenic
950908379 3:16560058-16560080 ACTCTCAAGCTTAACACCAGTGG + Intergenic
951120210 3:18917782-18917804 CCTCTCAATCTTCAAGTCTTTGG - Intergenic
952017338 3:28973365-28973387 CCTCAAAATCTTGAAATCTGAGG - Intergenic
952635219 3:35520936-35520958 TCTCTCATTCTTTCAACCTGAGG + Intergenic
953312484 3:41892637-41892659 CCTCCCAGTCTTAAAACTTGAGG + Intronic
953672944 3:44977751-44977773 CCTCTAAATTTAAAAACCTTTGG + Intronic
954309646 3:49755812-49755834 CCTCTAAATCTTACAACCAAGGG + Intronic
960479160 3:118168134-118168156 GCTCTCAATCTGTAGACCTGTGG + Intergenic
961427689 3:126860949-126860971 CCTCTCAATCTAAAAACCCAAGG - Intronic
963989802 3:151639942-151639964 ACTCTCAGTGCTAAAACCTGGGG + Intergenic
965891949 3:173525101-173525123 CCTCTCTAACTAAAAACCTGAGG - Intronic
967162173 3:186748543-186748565 CCTCCCAGTCTTGAAACTTGAGG - Intergenic
967400292 3:189053368-189053390 CCTCCCAGTCTTGAAACTTGAGG + Intronic
969117631 4:4881689-4881711 CCTTTCAATCTGGAAACCTGTGG + Intergenic
970349513 4:15187839-15187861 CCTCTCAATCCTCAAATCAGTGG - Intergenic
970368861 4:15388181-15388203 CTTCTCTATCTTTAAACCTCTGG - Intronic
973920735 4:55682331-55682353 CCTCTCAATCTTAAAACTTGAGG + Intergenic
975317851 4:72976253-72976275 CCTCTCAATGTTCAACCATGGGG + Intergenic
978550692 4:109922738-109922760 CCTATCAATTTCAAAAGCTGAGG - Intronic
979125274 4:116963980-116964002 CCTCTAAATATTAGAATCTGAGG - Intergenic
979457252 4:120940994-120941016 GTTCTCAATCTTAAACACTGGGG - Intergenic
979945476 4:126826084-126826106 CCTCTGGACCTCAAAACCTGTGG + Intergenic
981129349 4:141141285-141141307 CCTCTCAAACTTACATTCTGTGG + Intronic
981918284 4:150058818-150058840 CCTCTTAATTTTAAAAATTGTGG - Intergenic
983643169 4:169962775-169962797 CCTCTCACTCTTAGAACCTAAGG + Intergenic
983899811 4:173122000-173122022 TCTCTCATCCTTAATACCTGAGG + Intergenic
984470630 4:180168087-180168109 CCTGTGAATCTTATTACCTGTGG + Intergenic
990200642 5:53368824-53368846 CCTCTCATTCTAAAGAACTGTGG - Intergenic
993224603 5:85151399-85151421 GCTCTCAATCTTTCAACCTCTGG + Intergenic
996339460 5:122420135-122420157 CCTCTCCTTCTTCAAACCTATGG - Intronic
997964914 5:138349125-138349147 CTTCCCAATCTAAGAACCTGTGG + Exonic
1000814972 5:165909519-165909541 CTTCCCAGTCTTAAAACTTGAGG - Intergenic
1001760507 5:174204281-174204303 CCTTTCAGTTTTAAAAGCTGAGG - Intronic
1004789742 6:19011663-19011685 CCTCTAATTCCTGAAACCTGTGG - Intergenic
1005376570 6:25188499-25188521 CCTCTCAATTTCAAAACTTAAGG - Intergenic
1008295268 6:49768126-49768148 CCTTTTAATCTTTAAACCTTTGG + Intergenic
1011108663 6:83811937-83811959 CCTGGAAATCTTAAAACATGGGG + Intergenic
1012654458 6:101797223-101797245 CGTGTTAATCTTAAAAACTGTGG + Intronic
1013230884 6:108161410-108161432 CCTCTGAATCTCCAAACCTTGGG - Intronic
1014925787 6:127267763-127267785 CCTCTGCATCTTAAAAGCTGAGG + Intronic
1016023529 6:139260525-139260547 CTTTTAAATCTTAAAACCTGGGG - Intronic
1016797782 6:148136284-148136306 CCTCTCACTTTTTAAAACTGAGG + Intergenic
1023009872 7:35917024-35917046 CCCCTCATTATTAGAACCTGTGG - Intergenic
1023293315 7:38689590-38689612 CCTATTAAGCTTAAAAACTGAGG + Intergenic
1023670024 7:42566155-42566177 CCTAGCAATCTTTAAACCTAAGG + Intergenic
1024080962 7:45854584-45854606 CCCCTCATTATTAGAACCTGTGG + Intergenic
1025123533 7:56327215-56327237 CCCCTCATTATTAGAACCTGTGG - Intergenic
1027480523 7:78690880-78690902 CTTCCCGATCTTAAATCCTGTGG + Intronic
1027612521 7:80378777-80378799 CCTCTCAACTTCTAAACCTGTGG + Intronic
1027615958 7:80424410-80424432 TCCCTCAATCTTAAATCATGTGG - Intronic
1033999184 7:147390602-147390624 CCTCTCCATCTTACTACTTGAGG + Intronic
1034129557 7:148702463-148702485 CCTGTTAATGTTAAAAGCTGTGG - Intronic
1034233119 7:149548123-149548145 CCTCTCAGTCTTGAAACCCAAGG + Intergenic
1034883830 7:154782720-154782742 CCTCTGAATCTGAAACTCTGGGG - Intronic
1035920355 8:3669541-3669563 CCCCTCCTTCTGAAAACCTGAGG - Intronic
1037116414 8:15234832-15234854 TCTTTCTTTCTTAAAACCTGAGG + Intronic
1038977385 8:32715361-32715383 CCTCTAAGTCTGAAAACCTGAGG - Intronic
1038985231 8:32801775-32801797 CTTTTCAATCTTAAAACTTAGGG - Intergenic
1039242539 8:35572583-35572605 AGTCTCAATCTGAAAGCCTGGGG - Intronic
1039269764 8:35868119-35868141 CCTCGCAATCTTGCAACTTGAGG - Intergenic
1039803971 8:40983154-40983176 TCTCTCACTCTCAAAGCCTGAGG - Intergenic
1041080827 8:54213451-54213473 ACTCTCTATCTTAAAATCTTGGG - Intergenic
1042047845 8:64673864-64673886 TCTCTCATCCTTTAAACCTGTGG - Intronic
1042406614 8:68412914-68412936 CCTATCAAGCTTAAACTCTGTGG + Intronic
1043050682 8:75381455-75381477 CTTTTCAATCTTAACATCTGTGG + Intergenic
1046659667 8:116936021-116936043 CCCCAGAAGCTTAAAACCTGAGG - Intergenic
1047007245 8:120633224-120633246 CCACTTAATCCTCAAACCTGTGG + Intronic
1048663101 8:136629753-136629775 TTTCTTAAACTTAAAACCTGTGG - Intergenic
1052890316 9:33693412-33693434 CCAGAAAATCTTAAAACCTGAGG - Intergenic
1061622820 9:131823007-131823029 CCTCTGAATCTGAATTCCTGGGG + Intergenic
1186729859 X:12398147-12398169 TTTCTCAAAATTAAAACCTGAGG + Intronic
1187585248 X:20653647-20653669 ACTCTCATTCTTAAAACCATCGG - Intergenic
1187654498 X:21454969-21454991 CCTCTCTATATGGAAACCTGTGG + Intronic
1189657254 X:43257996-43258018 CCTCTGAATCTAAAAAAATGTGG - Intergenic
1189835196 X:45013232-45013254 CCTCTCAATCTTAAAACCTGGGG - Intronic
1193312908 X:80028040-80028062 ACTCTCGATTTTAAAACCTTTGG + Exonic
1194021006 X:88692406-88692428 CCTCTCAATAATAATACTTGTGG + Intergenic
1202587248 Y:26444494-26444516 TGTCTTAATCTTAAAATCTGAGG - Intergenic