ID: 1189835901

View in Genome Browser
Species Human (GRCh38)
Location X:45022429-45022451
Sequence TCTAGGGACGAGAAATATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189835901_1189835905 19 Left 1189835901 X:45022429-45022451 CCATGATATTTCTCGTCCCTAGA 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1189835905 X:45022471-45022493 TTTTTATCTCATCCTGACTTTGG 0: 1
1: 0
2: 0
3: 45
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189835901 Original CRISPR TCTAGGGACGAGAAATATCA TGG (reversed) Intronic
906354029 1:45087479-45087501 TGTAGGGTCCTGAAATATCAAGG + Intronic
910144579 1:84064832-84064854 CCTAGGGATGAGAAAAAACAGGG + Intergenic
910990537 1:93051561-93051583 TCTAGGCACTAGGGATATCATGG + Intergenic
912647522 1:111408281-111408303 GTTAGAGACAAGAAATATCATGG - Intergenic
913409943 1:118540796-118540818 TCCAGGTACTAGAAATAGCATGG + Intergenic
913479914 1:119278109-119278131 TCAAGGGAGGAAAAACATCAAGG - Intergenic
916950233 1:169772635-169772657 CATAGGCACCAGAAATATCATGG + Intronic
917775306 1:178327696-178327718 TCTAGGTACAAGAACTAACAAGG - Intronic
918262364 1:182807516-182807538 TCTAGGGTCCAAAAATATTAAGG + Intronic
918524193 1:185447194-185447216 TATAGGGATGAGAAATCACATGG - Intergenic
919801278 1:201356131-201356153 GCTAGGGAACAGAAAGATCATGG - Intergenic
921224618 1:213005860-213005882 TCTAGGCAACAGAAATAGCAAGG - Intronic
924433824 1:244021104-244021126 TCTAAGGAAGAGGAATATCTAGG + Intergenic
1065257889 10:23892616-23892638 TCCAGGGAGGAGAAATCTCATGG + Intronic
1067241588 10:44499664-44499686 TCTAGGGACTGGGAAGATCAAGG - Intergenic
1070441492 10:76450407-76450429 TTTAGTGACTAGAAATATTAGGG - Intronic
1070982691 10:80662402-80662424 TCTATGCACGTGAAATTTCAAGG + Intergenic
1071676957 10:87663575-87663597 TCAGGGGAGGAGAAATACCAGGG + Intronic
1073770330 10:106728588-106728610 TTTAGAGATGAGAAATCTCATGG + Intronic
1075641417 10:124067213-124067235 TCCATGGACGATAAATATCTGGG - Intronic
1078848546 11:15143238-15143260 TCTATGGAGGAGAAATACCGAGG + Intronic
1079538429 11:21543012-21543034 TCCAGGGAAGAGACATGTCAGGG + Intronic
1082106211 11:48224517-48224539 TCTAGAGAAGAGAAATTCCATGG + Intergenic
1083172683 11:60932234-60932256 TCTTGAGACGAGAAACCTCATGG + Intronic
1083450366 11:62740211-62740233 TCTAAGTATGAGAAATAGCAAGG - Intronic
1087323821 11:96697081-96697103 TCAAGGGAAGGGGAATATCAAGG + Intergenic
1087623129 11:100565176-100565198 GCTAGGAAGGAGAAATAACAAGG - Intergenic
1088304978 11:108398076-108398098 CCTAGGGAGAGGAAATATCATGG + Intronic
1089080063 11:115768214-115768236 GCTAGGGATCAGAAATATGAAGG - Intergenic
1090932633 11:131311957-131311979 TCTAAGGAGGAGAAACATCATGG + Intergenic
1092669824 12:10850261-10850283 TCTAGAAAAGAGAAAGATCATGG - Intronic
1093822480 12:23638272-23638294 TCTAGAGACCAGAAATAAGAAGG - Intronic
1099002716 12:77199591-77199613 TCTAAGGACAAGGAATTTCAAGG - Intergenic
1099042741 12:77676319-77676341 TCTAGGGAGTGGCAATATCAAGG - Intergenic
1107057559 13:36123877-36123899 TCTAGGGACCAGCAAAATTATGG - Intronic
1108272481 13:48775020-48775042 TCTCAGGACTAGAAATATAATGG + Intergenic
1109530494 13:63637796-63637818 TTTAGAGACTAGAAATATGATGG - Intergenic
1112675851 13:101700756-101700778 TCTTGGGACAAGAAATAGCTTGG - Intronic
1112780864 13:102899363-102899385 TCTAGGGAACAGAACTCTCAAGG - Intergenic
1114886625 14:26859698-26859720 TCTAGGGAACAGAAATGTGACGG + Intergenic
1121851786 14:97228051-97228073 TCTGGGCACCAGACATATCAAGG + Intergenic
1133653404 16:7834903-7834925 TCTTGGGAGGAGAAAAATCTGGG - Intergenic
1138236541 16:55388308-55388330 TCTAGGGACAGGGAATCTCATGG + Intergenic
1158252839 18:55508440-55508462 TTTAGAGAGGAGAAATATAATGG - Intronic
1168078911 19:53995039-53995061 TCTAGAGAAGAGAAAAATGAGGG + Intronic
926495127 2:13576745-13576767 TCTAGAAATGAGATATATCAAGG - Intergenic
929695156 2:44108215-44108237 TCTATGGACGAGGAAGATCTTGG + Intergenic
932178075 2:69620887-69620909 TCTAGGGAAGTTAAGTATCATGG - Intronic
933621857 2:84552215-84552237 TCTAGGAATCAGAAATATCTGGG + Intronic
943041658 2:182811820-182811842 TCTAGGGAGGAGAAAAATGAAGG + Intergenic
944087892 2:195870427-195870449 TCTAGGCAGAAGGAATATCAAGG + Intronic
944982087 2:205132870-205132892 TCTAGGCACAGGAAATAACAAGG - Intronic
1170254837 20:14329283-14329305 TTTAAGGAAGAGAAATATAAAGG - Intronic
1170528171 20:17261771-17261793 TGTAGGGAAGACAAATGTCACGG - Intronic
1173406690 20:42772405-42772427 TCTAGGGACTGGACATAACAGGG + Intronic
1178225688 21:30715540-30715562 TCTAGTGAATACAAATATCAAGG + Intergenic
1180013704 21:45069216-45069238 TCTGGGGAGGAGAAGCATCAGGG - Intergenic
1182005941 22:26959778-26959800 GCTAGGGATCAGAAATATGAAGG - Intergenic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
949342880 3:3048574-3048596 TCATGGGACGTGAGATATCACGG - Intronic
952164009 3:30725872-30725894 TCTAGGTACTAGAAATATTCAGG - Intergenic
956576957 3:70762597-70762619 TCTAGACATGAGAAAAATCATGG - Intergenic
963149020 3:142024500-142024522 TCCAGAGATGAGAAATTTCAAGG + Intronic
963359793 3:144256787-144256809 TCTAGCTACCAGAAACATCACGG - Intergenic
963638023 3:147823907-147823929 TGCAGGAAAGAGAAATATCATGG - Intergenic
964213092 3:154249934-154249956 TCTAGGGACAGGAAAAACCAGGG - Intronic
967391894 3:188964374-188964396 TCTAAGCACTAGAAATATGAAGG - Intronic
967855635 3:194115349-194115371 TCTCTGGAGGAGAAACATCAAGG + Intergenic
970144470 4:13020573-13020595 TCTTGCGACCAGAAACATCAAGG + Intergenic
970835642 4:20402592-20402614 TCTAGGTACAAGGAATAACATGG + Intronic
970947668 4:21714314-21714336 TAGAGAGCCGAGAAATATCAGGG - Intronic
971636037 4:29059174-29059196 TCTAGGGAGAAGAAAAATAATGG - Intergenic
975033272 4:69650745-69650767 TCTAGGGAAGAGAAAGAGAAGGG - Intronic
976583804 4:86771861-86771883 ACTAGGGACCAGAAATATAGAGG + Intronic
983015231 4:162605312-162605334 TCTAGGTACAAGGACTATCATGG + Intergenic
983423502 4:167551631-167551653 TCCAGGAATGAGAAATATCAGGG + Intergenic
985985515 5:3512538-3512560 TCAAGAGTCGAGAAACATCAAGG - Intergenic
988733609 5:33998325-33998347 TCTAGGGAAGAGTAAGATCTGGG + Intronic
992367871 5:76111835-76111857 ACCAGGGATGACAAATATCAGGG - Intronic
993000305 5:82374189-82374211 ACTAGGGATGAGAAAAATCCAGG + Intronic
1005819120 6:29582625-29582647 GCTAGGGCCGAGAAATGGCAGGG - Intronic
1010845016 6:80695718-80695740 TGTAGTGTCCAGAAATATCAAGG + Intergenic
1012352619 6:98271344-98271366 TCTAAGGAAGACAAATATAAAGG - Intergenic
1013360064 6:109385562-109385584 TCTAGGCAGAAGAAATAGCATGG - Intergenic
1026682987 7:72483588-72483610 TCAAGGCACAAGAAACATCAGGG - Intergenic
1029345050 7:99972367-99972389 TCTAGGGATGAGAAACAAAAGGG - Intronic
1030394511 7:108968790-108968812 TCTAGGGAGGAGGAAGCTCAGGG + Intergenic
1032494803 7:132352910-132352932 TCTTGGGAGGGGAAATATCTTGG + Intronic
1033231325 7:139600376-139600398 CCTAGGGAAGAGAAATCCCAGGG - Intronic
1039544602 8:38400168-38400190 TGTAGGGATGAGCAATAACAAGG + Intronic
1045947532 8:107813300-107813322 TATATGGAAGAGAAATACCAAGG + Intergenic
1045974527 8:108116330-108116352 TCTAGGGAGGAAAAAAATCAGGG + Intergenic
1046526204 8:115385088-115385110 TCTAGGAACTAGAAAAGTCAAGG + Intergenic
1046913969 8:119659889-119659911 TATTGGGACTATAAATATCAGGG + Intronic
1047679255 8:127237267-127237289 CCTAGAGAAGAGAAATCTCAGGG + Intergenic
1047984799 8:130221489-130221511 TATAGGGAAGATAAATATAAGGG - Intronic
1048419781 8:134266658-134266680 TCTAGAGACCTGAAATATGAAGG - Intergenic
1060783643 9:126432212-126432234 TCTAAGGAAGGGAATTATCAGGG - Intronic
1188941236 X:36240671-36240693 TCTACAGAAGAGAAATATAATGG + Intronic
1189835901 X:45022429-45022451 TCTAGGGACGAGAAATATCATGG - Intronic
1193643077 X:84035389-84035411 TTTAGGAAGGAGAAATATCAGGG + Intergenic
1195677478 X:107517992-107518014 TCGAGGGATGAGATATAGCAGGG + Intergenic
1197837250 X:130708631-130708653 TCTAGGCACTAGAAATAACAAGG - Intronic
1198145575 X:133853361-133853383 GCTAGGGAAGAGGAATATGAGGG - Intronic
1198383105 X:136102972-136102994 TATAAGTACAAGAAATATCAAGG - Intergenic
1199732285 X:150647416-150647438 TCGAGGGAAGGAAAATATCAGGG + Intronic