ID: 1189839484

View in Genome Browser
Species Human (GRCh38)
Location X:45058537-45058559
Sequence TTCCCAAGTAACAACACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189839484 Original CRISPR TTCCCAAGTAACAACACTGA GGG (reversed) Intronic
904130511 1:28272295-28272317 CTACCAGGTAAGAACACTGATGG - Exonic
905677508 1:39838037-39838059 TTCTCACGTAACAGCTCTGAAGG - Intergenic
907382061 1:54099220-54099242 TTTCCAACTATCACCACTGAAGG - Exonic
908697047 1:66855246-66855268 TTCCCTAGTAACCACAATAAAGG + Intronic
911163157 1:94701564-94701586 TTCAGAAGTAACTCCACTGATGG - Intergenic
913507879 1:119534743-119534765 TTCCCAAGGCACCACAGTGAAGG - Intergenic
914005186 1:143726597-143726619 TTGCTAAGTAACATCACTTAAGG + Intergenic
916207714 1:162331671-162331693 TTCACCACTAACAACACTGATGG - Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
918373800 1:183888189-183888211 TTTCCTAGTAAAAACACTAATGG - Intronic
918962702 1:191301202-191301224 CTCACAAGTAACAACACCCATGG - Intergenic
921441194 1:215188358-215188380 TTCCCAAGTAAAAAATGTGATGG - Intronic
922999265 1:229992895-229992917 TACCCAAGAAACAAAGCTGAGGG + Intergenic
923641221 1:235763351-235763373 TTCCCAAAGAACAAAACAGAAGG - Intronic
1064290803 10:14032564-14032586 TTCCCAGGCAGCAACAGTGAGGG - Intronic
1064391409 10:14945516-14945538 TTTCCAAGTAACAATGGTGAGGG - Intronic
1064906815 10:20356149-20356171 GTCACATGTCACAACACTGAAGG + Intergenic
1065052635 10:21811351-21811373 TTCGCAAGTAACAACATATATGG - Intronic
1066590692 10:36990891-36990913 TTCTGAAGTAAAAACACTGCAGG + Intergenic
1069237982 10:66102450-66102472 TTCCCAAGTAACACTCCAGAAGG + Intronic
1070441975 10:76455483-76455505 CACCCCAGTAAAAACACTGATGG + Intronic
1070535381 10:77373479-77373501 TTCCAAAATAACAACAATAATGG + Intronic
1070700943 10:78601363-78601385 TTCCTAAGATACAACTCTGAGGG - Intergenic
1071083923 10:81845867-81845889 TTCCCAAGTAACAAATGTGCAGG - Intergenic
1071614819 10:87065869-87065891 CTCCCAAGTCACAGCACTGATGG + Intronic
1076312935 10:129521218-129521240 TTCCCAAATAATGAAACTGAGGG - Intronic
1077758420 11:5062315-5062337 TACCCAACAAACAACACTGAGGG - Intergenic
1077907285 11:6544365-6544387 ATCCCAAGAAACAGCCCTGAAGG - Intronic
1078164181 11:8868645-8868667 TACCTATGTCACAACACTGAAGG + Intronic
1079677577 11:23249984-23250006 TTCCCAGGAAACAAAATTGAGGG - Intergenic
1080066035 11:28014724-28014746 TTCTGAAATAACCACACTGAAGG + Intergenic
1087063809 11:94009328-94009350 TACCCAAGCAACAACACAGCTGG + Intergenic
1088229903 11:107663073-107663095 TTCTCTGGTGACAACACTGACGG - Intronic
1088668581 11:112119222-112119244 TTCCCAAGTAACGAGACTACAGG + Intronic
1089467209 11:118693003-118693025 TTCCCAAGAGACCCCACTGAAGG + Intergenic
1089479944 11:118796441-118796463 TTGCCGAGGAATAACACTGATGG + Intergenic
1090628639 11:128627319-128627341 TCCCCAAGTCAAAACACTCAAGG + Intergenic
1091067101 11:132524927-132524949 TTCCCCAGAAACATCAATGATGG + Intronic
1097719889 12:63009074-63009096 ATCCCAACTAACAACTATGAAGG + Intergenic
1097927509 12:65145939-65145961 TTCCCAGGTAAAAATCCTGAAGG + Intergenic
1098098933 12:66991881-66991903 TTCCAAATTTACAACACTAATGG + Intergenic
1099316780 12:81093597-81093619 TTCCAAAAAAAAAACACTGAAGG - Intronic
1099439000 12:82678424-82678446 TTCCGAAGTAAGAACACAAAAGG - Intergenic
1100756796 12:97760065-97760087 TTCCTAATTAAAAACACAGAAGG + Intergenic
1101497943 12:105273347-105273369 TTCCCAAGAAACAAAACGGTTGG + Intronic
1101958287 12:109229505-109229527 TTCTCAGGTGAGAACACTGAGGG - Intronic
1102297542 12:111748518-111748540 TCCCCAGGAAACACCACTGAGGG + Intronic
1103102238 12:118188142-118188164 TTCACATGTAAAACCACTGATGG + Intronic
1103876671 12:124132887-124132909 GTTCCTAGTGACAACACTGATGG + Intronic
1104058548 12:125248889-125248911 TTCCCCAGGAAGAAGACTGATGG - Intronic
1105963764 13:25366925-25366947 TTCCCAAAGAACAACATTGAAGG - Intergenic
1106076087 13:26462387-26462409 TTCATCAGTCACAACACTGATGG - Intergenic
1107385759 13:39907218-39907240 TTCCCAGATAACATCACTGGAGG - Intergenic
1109772760 13:66998317-66998339 TTCCCAAGGAACAACTCTATTGG - Intronic
1110334001 13:74305083-74305105 TTCCCCAGTAACAATTTTGAGGG + Intergenic
1112700840 13:102006351-102006373 TTGCCAATCAACAATACTGATGG + Intronic
1113002537 13:105659086-105659108 TTTCCAAGTTTGAACACTGATGG + Intergenic
1114777524 14:25501272-25501294 CAACCAAGTAAGAACACTGAGGG - Intergenic
1115270381 14:31544964-31544986 TTCCCAAGTAATAAGAGTGACGG - Intronic
1117246777 14:53894520-53894542 TTCCAAACTAACAAAGCTGAGGG + Intergenic
1119109250 14:71956250-71956272 TTACCAAATTCCAACACTGATGG - Intronic
1119312901 14:73665094-73665116 TTCCCAAGTAACTATAATAATGG - Intronic
1120841639 14:89090745-89090767 TGCAAAAGTAACAATACTGACGG - Intergenic
1127490694 15:59459897-59459919 TTCCCAATTAACAACCCTCATGG + Intronic
1129650382 15:77482991-77483013 CTCACAAGTAAAAACACTTATGG - Exonic
1130030201 15:80306991-80307013 TTCCCATAAATCAACACTGATGG - Intergenic
1130660659 15:85829393-85829415 CTCCCAGGTAACAACTCTGAAGG + Intergenic
1138925480 16:61585179-61585201 TTCCAAAGAAACCACAGTGAAGG - Intergenic
1141914667 16:87087005-87087027 TTCCCAAGTAAACACCCTGATGG - Intronic
1143794303 17:9324341-9324363 TTCCAAATTAACAACTCTGGAGG + Intronic
1143807691 17:9442768-9442790 GTCCCAAATTACAGCACTGAGGG + Intronic
1148921616 17:51040280-51040302 TTGCCCAGTAACATCACTGTGGG + Intronic
1150260220 17:63783448-63783470 TTCCCAAGCAACAAAAAGGATGG - Intronic
1151426736 17:74035574-74035596 ATCCCAAGGAACCACAGTGAAGG - Intergenic
1157852998 18:51075119-51075141 TTCCCAATTAGCACCAATGAAGG - Intronic
1158540503 18:58349229-58349251 TTCCCTAGTAACATCACTGCTGG + Intronic
1158664992 18:59424276-59424298 TTCCCAAACAGCAGCACTGAAGG + Intergenic
1160146234 18:76367384-76367406 TTCTCAAGCTACAACTCTGACGG + Intronic
1163274624 19:16275683-16275705 TTCCCCAGTAACAACCTTTATGG + Intergenic
1165094592 19:33403249-33403271 TGGCCAAGTCACGACACTGATGG + Intronic
1168113549 19:54208496-54208518 TTCCCAAGTAGCAACGCTGAGGG - Intronic
925259863 2:2519962-2519984 TTCCCAAAGAACAACCCCGATGG - Intergenic
928446801 2:31339959-31339981 TTCCCCAGTAGCAACATGGAAGG - Intronic
934485311 2:94702953-94702975 TTCCCAAGTAAAAAAACCGGTGG - Intergenic
936646347 2:114376797-114376819 ATCCCTAGAAACATCACTGAAGG + Intergenic
937945093 2:127326715-127326737 TTCACTAGTATCAACAGTGAAGG - Exonic
938910770 2:135883928-135883950 TTCCTAATTAACAAGAATGAAGG + Intergenic
939080646 2:137657201-137657223 CTCACAAATAACAACACTCAGGG - Intronic
939250594 2:139676770-139676792 TTCACAAGTAAAGAAACTGAAGG - Intergenic
941388670 2:164884462-164884484 TTCCCAAGTTTCAACAATTATGG + Intergenic
944300497 2:198119453-198119475 TTTCCAAGAAACAGAACTGAGGG - Intronic
946988644 2:225302937-225302959 TTCCCAAGTAAGGACTCTGTAGG - Intergenic
1168916089 20:1489576-1489598 AGCCCAAGTGACAACACAGAAGG - Intronic
1170029228 20:11927436-11927458 ATCCCAAGTCCCAACAATGAAGG - Intergenic
1170269163 20:14504628-14504650 TTCCCAGGAAATAACTCTGAGGG - Intronic
1172458267 20:35094658-35094680 TTTCTAAGAAACAACACTCAGGG - Intergenic
1174493948 20:50925714-50925736 TTCCAAACTAACAACATAGAAGG + Intronic
1179016953 21:37602218-37602240 TTCCCAAGCAAGCACAATGATGG + Intergenic
1183751592 22:39724064-39724086 TTCCCAAGCACCTACACTGTGGG - Intergenic
1185079964 22:48704156-48704178 TTCTCTAGCACCAACACTGAAGG - Intronic
949156932 3:839033-839055 TTCCCAGTTAATAACAGTGAGGG - Intergenic
949247851 3:1946546-1946568 TTCTCATGTAACAAGTCTGATGG + Intergenic
951808663 3:26675790-26675812 TTCCCAAGAAACAACAATTAAGG - Intronic
954270373 3:49503226-49503248 TTCCAATGTGACACCACTGAGGG - Intronic
955214648 3:56974931-56974953 TTCCCACGCACCGACACTGAGGG + Intronic
957553917 3:81741445-81741467 TTCCCAAATGTCAACACAGATGG + Intronic
960722014 3:120633722-120633744 TTCCCAAGTAGCTCCACTGTAGG + Intronic
962986772 3:140543490-140543512 GTGGCAAGTAACAACACTGTGGG + Intronic
963309082 3:143688401-143688423 TTCCCTGGTCCCAACACTGAAGG - Intronic
964631142 3:158812044-158812066 TTTTCAAGTAACAATAGTGAAGG + Intronic
964753683 3:160075432-160075454 TTCCCAAAAAACATCACTGCTGG - Intergenic
969098397 4:4751367-4751389 TTCCCAAGTGACAGCCCTGCTGG + Intergenic
970835932 4:20407525-20407547 CTGCCAAGTAGCAACGCTGAAGG - Intronic
971204592 4:24552599-24552621 TTACCAAGTAAAAATAATGAAGG + Intronic
971747884 4:30608188-30608210 ATCCCAATTAAAATCACTGAAGG + Intergenic
978568127 4:110106464-110106486 TTCCCCAGGAACAGAACTGAGGG + Intronic
979654049 4:123170854-123170876 TGCCCAAGTCACAAAACTAACGG - Intronic
980335737 4:131470508-131470530 TATCCAAGAAACAACATTGATGG + Intergenic
983826473 4:172268418-172268440 TTAGCAAGTGACGACACTGAAGG - Intronic
990651359 5:57903452-57903474 TACACAAGTAACAGCAATGAAGG + Intergenic
991633430 5:68679879-68679901 CTCCCAAGGAGTAACACTGATGG - Intergenic
993733804 5:91451955-91451977 TACCCAAGGAACCACAATGAAGG - Intergenic
997202409 5:132019188-132019210 TTCCCAGGGAAGAACTCTGATGG - Intergenic
997849505 5:137318422-137318444 TTTCCAGGTAGCAGCACTGAGGG + Intronic
999865513 5:155696364-155696386 TTCCCTAGTAACAAGATTTATGG + Intergenic
1000615537 5:163421820-163421842 TTCCCAAGTTACAGAATTGATGG + Intergenic
1003038162 6:2662727-2662749 TTCCAAAGTCCCAACACTGAAGG - Intergenic
1003727977 6:8787916-8787938 TTCCTCAGTAAGAAGACTGAAGG + Intergenic
1012855476 6:104496448-104496470 TTACCAAGAAACAAATCTGATGG - Intergenic
1013769388 6:113610520-113610542 TTCCCAAGTAAAAACCTTTATGG + Intergenic
1014592927 6:123294786-123294808 TTACCAAGTAAAAACAGTGCTGG + Intronic
1014664156 6:124215720-124215742 TTCCTAAGAAAGAACACTGCAGG - Intronic
1015032780 6:128615930-128615952 TTCCCAAATAAAAAAACTGAGGG - Intergenic
1017506738 6:155075325-155075347 TTCCCAAGTAACGACACAAAAGG - Intronic
1022150514 7:27599187-27599209 ATCCAAAATAACAACTCTGACGG - Intronic
1023663687 7:42496758-42496780 TTTCCAAGTAAGAAAAATGAAGG - Intergenic
1024480676 7:49858764-49858786 TACATAAGTAACAAAACTGAAGG - Intronic
1027008496 7:74720060-74720082 CTCCCAAGTCCCAATACTGAGGG + Intronic
1027546649 7:79535434-79535456 TTCCCAAGTCACAAGATTAAAGG + Intergenic
1030276451 7:107726695-107726717 TACCCAAATACCATCACTGAGGG + Intergenic
1031256025 7:119450075-119450097 TCCACTAGAAACAACACTGATGG + Intergenic
1031565795 7:123295728-123295750 TTCCCAAGTAAAAATTCTGCTGG - Intergenic
1031654321 7:124333460-124333482 TTCCCAAGTAAAAAAACTGAAGG + Intergenic
1031660855 7:124422406-124422428 CACCCAAGTAAGAAAACTGAGGG - Intergenic
1035047205 7:155975532-155975554 TTCCTGAGCAACAACACTCAGGG - Intergenic
1036108390 8:5869682-5869704 TTTCCAAGAAACAACTCTTACGG + Intergenic
1036376069 8:8200588-8200610 TTTGCAAGTACCAACACTGCTGG + Intergenic
1036826602 8:11981385-11981407 TTTCCAAGTGAGAAAACTGATGG + Intergenic
1036853459 8:12222550-12222572 TTTGCAAGTACCAACACTGCTGG - Intergenic
1036874835 8:12465072-12465094 TTTGCAAGTACCAACACTGCTGG - Intergenic
1039781781 8:40793319-40793341 TTGCCAGGTAAGAAGACTGAAGG + Intronic
1041158648 8:55014266-55014288 TGACCAAGTCACAACTCTGAGGG - Intergenic
1042059220 8:64798924-64798946 TTCCCAAGAACCAGCCCTGAAGG + Intergenic
1044110827 8:88271264-88271286 TTACTAAGGAATAACACTGATGG + Intronic
1048917253 8:139197149-139197171 TTACCAAGTACCCACACTGGAGG - Intergenic
1049504541 8:142988946-142988968 TTCCCAATTAATCACACTCATGG + Intergenic
1052733902 9:32320627-32320649 CTCCCAGTTATCAACACTGAAGG + Intergenic
1054383597 9:64521437-64521459 TTCCTAAGTAAAAAAACTGGTGG + Intergenic
1054512142 9:65994904-65994926 TTCCTAAGTAAAAAAACTGGTGG - Intergenic
1055429199 9:76226896-76226918 TTCCCAAGGAAAAACACATATGG - Intronic
1055775236 9:79760594-79760616 TTCCCAAATCACCACATTGAAGG + Intergenic
1058300957 9:103372496-103372518 TTCACAAGTAAGAAAGCTGAAGG + Intergenic
1058705737 9:107636908-107636930 TTACCAAGCAAAAACAATGATGG - Intergenic
1060886002 9:127152831-127152853 TTCTCAAGTAACTTCATTGAGGG + Intronic
1062266969 9:135690951-135690973 TGGCCATGGAACAACACTGAGGG + Intergenic
1189592547 X:42530374-42530396 TTCCCAGGAAAAAACACTAAGGG - Intergenic
1189839484 X:45058537-45058559 TTCCCAAGTAACAACACTGAGGG - Intronic
1192474645 X:71429716-71429738 TTCCCAGTTAAAAATACTGACGG + Intronic
1194006663 X:88503239-88503261 TTCCCACTTAACAAAGCTGAAGG - Intergenic
1195738788 X:108041102-108041124 TTCCCAAGGAAGAATACTGGGGG + Intergenic
1195738839 X:108041808-108041830 TTCCCAAGGAAGAATACTGGGGG + Intergenic
1196356315 X:114797650-114797672 TTCCCAAGTGAGAACACTTATGG - Intronic
1202021119 Y:20466201-20466223 TTCCCATGTCACAACAATGGTGG - Intergenic
1202597064 Y:26551374-26551396 TGCCCAAGTCAAAATACTGACGG - Intergenic