ID: 1189843008

View in Genome Browser
Species Human (GRCh38)
Location X:45102113-45102135
Sequence ACACTACAAATCTGAGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189843007_1189843008 -6 Left 1189843007 X:45102096-45102118 CCAGTCTATTGAAAAATACACTA 0: 1
1: 0
2: 0
3: 20
4: 405
Right 1189843008 X:45102113-45102135 ACACTACAAATCTGAGACATTGG 0: 1
1: 0
2: 0
3: 13
4: 148
1189843006_1189843008 30 Left 1189843006 X:45102060-45102082 CCTAAAAACACAGTGATTCGTGA 0: 1
1: 0
2: 1
3: 6
4: 157
Right 1189843008 X:45102113-45102135 ACACTACAAATCTGAGACATTGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189843008 Original CRISPR ACACTACAAATCTGAGACAT TGG Intronic
904380216 1:30105564-30105586 ACAATGCAAAGCTGAGACAGAGG + Intergenic
906774948 1:48520904-48520926 ACACTACAAATGGGAGCCAGAGG - Intergenic
907840130 1:58148917-58148939 ACACCACAGCTCTGAGACAGGGG - Intronic
907945907 1:59136497-59136519 AGCCCACAAATCAGAGACATAGG + Intergenic
908705383 1:66948363-66948385 AAACTAAAATTATGAGACATAGG - Intronic
916574343 1:166053921-166053943 ACAGTACAAATGTGAGGCTTTGG - Intergenic
917603865 1:176605106-176605128 GCTCTAAAAATCTGAAACATGGG + Intronic
918273494 1:182926891-182926913 ACTCTATAAATATGAAACATAGG + Intronic
921062679 1:211598980-211599002 AGACTACAACCCTGAGACGTGGG + Intergenic
921830340 1:219721636-219721658 ATACCACAAATATGTGACATAGG + Intronic
921919651 1:220652961-220652983 ACATTAGAGATGTGAGACATGGG - Intronic
924217999 1:241845240-241845262 TCCCTCCAAATCAGAGACATGGG - Intergenic
924667633 1:246089860-246089882 AAACTACCAATTTCAGACATAGG - Intronic
924826195 1:247541594-247541616 ACACTCCAAATTTGAGATGTTGG + Intronic
1063193179 10:3717217-3717239 ACGGTATTAATCTGAGACATAGG + Intergenic
1063528134 10:6803425-6803447 ACTCTACAAATTTCAGAGATGGG + Intergenic
1063699955 10:8374716-8374738 ACGCTACAAAACTGAGCCTTTGG + Intergenic
1068368050 10:56077383-56077405 AAACTAAAAATCTGAGCCATGGG + Intergenic
1068439515 10:57032820-57032842 GCATTACAAATGTGAGAAATTGG - Intergenic
1071610369 10:87026459-87026481 ACATTCCAAAGCTAAGACATTGG - Intergenic
1073486692 10:103823744-103823766 ACACTACAACTCACAGACTTTGG + Intronic
1074885610 10:117690625-117690647 AAACTACAAATATGATACACAGG - Intergenic
1077780821 11:5327594-5327616 ACAATAGAAATCTGAGAGTTGGG - Intronic
1082815638 11:57506795-57506817 TCACTACAAATCTGTGATACAGG - Intronic
1086309414 11:85519461-85519483 ACATTCCAAATAGGAGACATTGG - Intronic
1087270029 11:96101608-96101630 CCACTAAAACCCTGAGACATGGG - Intronic
1087824651 11:102751560-102751582 TCACAACAAATCTGAGAGGTAGG + Intergenic
1092115720 12:6002045-6002067 ACACTACATATCAGACTCATTGG + Intronic
1094767480 12:33613519-33613541 ATATTACACATCTGAAACATTGG + Intergenic
1095389095 12:41684511-41684533 TCACTACAAATCAGAGGAATGGG - Intergenic
1098688666 12:73458397-73458419 ACCCTATAAATCTGAGCCAAAGG - Intergenic
1101592470 12:106137105-106137127 AAACATCAAATCTGAGAAATGGG + Intronic
1104340847 12:127947002-127947024 ACACTTCTAGGCTGAGACATAGG - Intergenic
1104871569 12:132002184-132002206 ACACTCCAATTTAGAGACATAGG - Intronic
1107024106 13:35782165-35782187 GCACTACTAATCTTAAACATAGG + Intronic
1109105862 13:58250063-58250085 ACGCTCCAAATCTAAGACAAAGG + Intergenic
1109523170 13:63539367-63539389 ACACTACTAATCTGCTACAATGG - Intergenic
1115910119 14:38246945-38246967 TCATTAGAAATCTGAGATATAGG + Intergenic
1118802642 14:69205182-69205204 ACACAACAAAGCAGAGACATGGG - Intronic
1118979017 14:70701222-70701244 AAACAACAAATGTGAGACAAAGG + Intergenic
1119189663 14:72672150-72672172 GCACTACAAAGGTGAGAAATAGG + Intronic
1121228368 14:92338595-92338617 ACACTACAAATGTCTGACTTTGG + Intronic
1125424871 15:39538614-39538636 CTGCTACAAATCTGAGCCATGGG + Intergenic
1126401971 15:48281215-48281237 AAACAACAAATCTGTGACGTAGG - Intronic
1130708344 15:86254635-86254657 TCCCTCCAATTCTGAGACATTGG + Intronic
1137786603 16:51142386-51142408 ATACTACAAATGGGAGACATTGG + Intronic
1140483520 16:75276328-75276350 ATAATACAATTCAGAGACATAGG + Intergenic
1142787602 17:2236330-2236352 AAACTAAATATCTGAGACAATGG + Intronic
1145845978 17:28039813-28039835 AAAATACAAATCTGAGACCAGGG - Intergenic
1146033505 17:29386723-29386745 TCACTATAAGTCTGAGACATGGG + Intergenic
1149030356 17:52075862-52075884 ACACTACAATTCAGATAGATGGG - Intronic
1150116212 17:62552121-62552143 ACAATTCAAATATGAGACAAAGG - Intronic
1150449901 17:65258056-65258078 ACCCTACAAATCAATGACATTGG - Intergenic
1155501935 18:26495169-26495191 ACACTACAGTTCGTAGACATGGG - Intronic
1156559337 18:38104731-38104753 CCACTTCAAATCTGTAACATTGG - Intergenic
1158674528 18:59506339-59506361 AGACCACAAATCTGAAACCTAGG - Intronic
1159617616 18:70599203-70599225 CCACTCCAAATGTGAGAAATTGG - Intergenic
1159674248 18:71261800-71261822 ACACTACAATGCAAAGACATTGG - Intergenic
1162715481 19:12629263-12629285 ACTCTATAAATGTGAGAAATAGG + Exonic
1164125993 19:22318107-22318129 ACACTACAAATGTGAAGAATGGG + Intergenic
1166261067 19:41641140-41641162 AAACTAAGAATCTTAGACATGGG - Intronic
1167873629 19:52393665-52393687 ATTATACAAATCTGACACATAGG - Intergenic
926923976 2:17968228-17968250 ACACTAAAAATCTGTGGCAGAGG + Intronic
929207058 2:39308636-39308658 ACAATAAAAAAATGAGACATTGG - Intronic
929494417 2:42427882-42427904 ATAATACAAATCTAAGTCATAGG + Intergenic
933071830 2:77868568-77868590 AAACTACAATTCCCAGACATTGG + Intergenic
936666783 2:114606157-114606179 TCACTTGAAATCTGAAACATGGG + Intronic
938323128 2:130378713-130378735 ACAATGCAAATTTGAAACATTGG - Intergenic
940529735 2:154866152-154866174 ACACTATAAATGTTATACATAGG - Intergenic
941815810 2:169794971-169794993 AGATTACATATCTGAGATATAGG + Intronic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
945887918 2:215396543-215396565 ACATTCCAAATATGTGACATTGG + Intronic
946040129 2:216776000-216776022 ACCCTCCAAAGCTAAGACATGGG - Intergenic
1170471155 20:16669576-16669598 ACACTACAAGTGTCAGTCATTGG + Intergenic
1171845782 20:30273650-30273672 ACAATAAAATTCTGAGACAATGG - Intergenic
1174159638 20:48541629-48541651 ACACCAGACATCTGAGACAGAGG + Intergenic
1174840528 20:53897524-53897546 ACATTAAAAATCAGAGACTTAGG + Intergenic
1180678369 22:17604875-17604897 ACATTTAAATTCTGAGACATTGG - Intronic
1181431154 22:22882610-22882632 TCTCTACAAATATGAGACACAGG - Intronic
1181999843 22:26911341-26911363 TCACAACATTTCTGAGACATTGG + Intergenic
951095446 3:18624497-18624519 ATACTACCAATCTTTGACATAGG - Intergenic
951550785 3:23873172-23873194 ACAGTACAAATGTGAGAAAATGG + Intronic
952079061 3:29735273-29735295 ACACTAAAAACCTGAGAAAAAGG + Intronic
952797042 3:37248809-37248831 TCACTGCAAATCTGAAAAATTGG - Intronic
952971952 3:38656918-38656940 ACCCTACAAAGCTCAGACCTGGG - Intergenic
954531799 3:51327579-51327601 AATCTAGAAATCTGAAACATGGG - Intronic
956580997 3:70813138-70813160 ACACAAAAAAACTGAGACTTTGG + Intergenic
959389535 3:105757668-105757690 AGACTAAAAATCAGATACATGGG + Intronic
960641696 3:119831067-119831089 ACACAGCAAATCTGAGAAATAGG + Intronic
964083352 3:152787148-152787170 ACACTGTAATTCTGACACATGGG - Intergenic
968354137 3:198088793-198088815 CCATTACAAATTGGAGACATGGG - Intergenic
970701233 4:18742110-18742132 TCACTACAAATCCAGGACATAGG + Intergenic
972063521 4:34910610-34910632 CCATTAAAAATCTGAGAAATTGG - Intergenic
974069149 4:57108963-57108985 ACAATACAAATCAAAGAAATAGG + Intronic
975163556 4:71151229-71151251 ACACAACAAATGTTAGTCATTGG - Intergenic
976798887 4:88965392-88965414 ACATTACAAAGGTCAGACATCGG + Intronic
977347529 4:95836253-95836275 AGAATAAAAATTTGAGACATGGG + Intergenic
979661272 4:123258561-123258583 ACACTCCAACTCTGAGAAAATGG - Intronic
980005286 4:127535074-127535096 AGACTACAAGTCTAAGACAGAGG + Intergenic
980166279 4:129231882-129231904 ACACTGCAAATCGGATTCATAGG - Intergenic
980202967 4:129678823-129678845 AACCTACCAATCTGTGACATTGG - Intergenic
981061771 4:140432347-140432369 CCACTACAAATGGGAGAAATTGG - Intergenic
981135040 4:141201126-141201148 ACATAACTAATATGAGACATAGG + Intronic
987884945 5:23800788-23800810 ACAATTCAAATGAGAGACATTGG - Intergenic
990749026 5:58991920-58991942 ACTCCACTGATCTGAGACATTGG + Exonic
990753323 5:59040512-59040534 ACACTACAATTTTGAGAAAACGG + Intronic
990759608 5:59113821-59113843 TCACCACAAATCTGTGAGATTGG - Intronic
991143243 5:63271839-63271861 ACACTACAAAGCCAACACATAGG - Intergenic
994243430 5:97450460-97450482 ACATGACAAATATGAGACATGGG - Intergenic
994377058 5:99026757-99026779 ACTCTACAAATCACAGACTTGGG - Intergenic
994795586 5:104294802-104294824 ACAATATAAAGCTGAGAGATGGG - Intergenic
996110970 5:119566037-119566059 CAGCTACAAGTCTGAGACATGGG + Intronic
999466240 5:151808660-151808682 ACCTTACAAATCTGGGACACTGG - Exonic
1000756162 5:165162657-165162679 ACACTACAAATTGCAGACACTGG - Intergenic
1000818627 5:165955949-165955971 ACACTAGTAATCTGAGAAAGGGG - Intergenic
1002053231 5:176583818-176583840 ACACAATAAATCCGAGAGATGGG + Intronic
1006874164 6:37280753-37280775 ACACTGCAAAGCTGAGACAGAGG - Intronic
1006874178 6:37280916-37280938 ACACTGCAAAGCTGAGACAGAGG - Intronic
1007061891 6:38948163-38948185 ACACCACAGATATGAGACTTTGG + Intronic
1007972660 6:46068313-46068335 ACCCTACAAAGCTGATACAGAGG + Intronic
1009061631 6:58403181-58403203 ACAATGGAAATCTGAGACACCGG + Intergenic
1009249305 6:61277729-61277751 ACAATGGAAATCTGAGACACTGG + Intergenic
1009714649 6:67374908-67374930 ACACTAGAAAGATGATACATCGG - Intergenic
1013650911 6:112193554-112193576 ACACCAAGAAACTGAGACATGGG - Intronic
1015694020 6:135959282-135959304 ATACTACAAATCTGAGAGTTTGG + Intronic
1021004030 7:15371253-15371275 ACACTACAAACCTGAGTGATGGG - Intronic
1021633233 7:22666280-22666302 TCACCATAAATCTGTGACATGGG - Intergenic
1021639271 7:22722242-22722264 ACTCTGTAATTCTGAGACATTGG - Intergenic
1024342641 7:48282876-48282898 TCACTACAAACCTGGCACATGGG + Intronic
1024377190 7:48653357-48653379 ACAAAACAAATCTGAGATATGGG - Intergenic
1024839511 7:53568970-53568992 AGAATATAAATGTGAGACATTGG + Intergenic
1025632334 7:63286371-63286393 CCACTACAAATGGGAGAAATTGG + Intergenic
1025650229 7:63459861-63459883 CCACTACAAATGGGAGAAATTGG - Intergenic
1027487972 7:78785930-78785952 ACACTATGAATGTGAGACAGAGG + Intronic
1028341468 7:89725805-89725827 TCACAACAAATCTGGGAAATTGG - Intergenic
1032045945 7:128607937-128607959 ACAATTCAAATATGAGACAAAGG - Intergenic
1033046560 7:137967660-137967682 ACACTCCAGTTCAGAGACATGGG - Intronic
1037632151 8:20667837-20667859 ACATTACAACTCTGAGTTATGGG - Intergenic
1043229444 8:77782862-77782884 ACACTATAAATGTGAGACCTTGG + Intergenic
1045721132 8:105112197-105112219 ACAGTAAAAATCTGAGTCATAGG - Intronic
1045993039 8:108332465-108332487 ACACTAAAAAACAAAGACATAGG + Intronic
1046068765 8:109225218-109225240 CCACTCCACAGCTGAGACATTGG + Intergenic
1048360005 8:133689603-133689625 ACTTTACAAATCTGAGGCCTTGG - Intergenic
1048722194 8:137338175-137338197 ACATTTCAAATCTCAGAAATGGG + Intergenic
1050168899 9:2795258-2795280 AAACTACAACTCTGTGACTTGGG + Intronic
1050945874 9:11516309-11516331 TTACTAGAAATCTGAAACATTGG - Intergenic
1052614077 9:30815716-30815738 ACACTAGCAATCTGAGAGAATGG - Intergenic
1055857570 9:80708930-80708952 CCACAACAACACTGAGACATAGG - Intergenic
1059369962 9:113822140-113822162 ACACTTCAAATCTAATAAATGGG + Intergenic
1059691519 9:116689328-116689350 TCACAACAATTCTGTGACATTGG - Intronic
1060841252 9:126794748-126794770 AAACTTCAAATATGAGGCATTGG + Intergenic
1061428538 9:130516495-130516517 ACATTACAAATTTTAGAGATGGG - Intergenic
1061995966 9:134186011-134186033 ACACAAAACATCTGACACATGGG - Intergenic
1186949437 X:14606958-14606980 TCACTACAACTCTGTGTCATTGG - Intronic
1186996174 X:15125533-15125555 AAACTAGAATTCTGAGACTTGGG - Intergenic
1187265927 X:17733244-17733266 ACACAACAAATCACAGCCATGGG - Exonic
1187506823 X:19885541-19885563 ACAGTTCAAATCTGAAAAATAGG + Intronic
1189843008 X:45102113-45102135 ACACTACAAATCTGAGACATTGG + Intronic
1191786630 X:64923403-64923425 AGACTACAAATCTGAGTAAGGGG - Intronic
1194017831 X:88647514-88647536 ATAATACAAATCTGAGAAAAAGG - Intergenic
1194526158 X:94979744-94979766 AAACTAAAAATTTGAGCCATTGG + Intergenic
1194929489 X:99868427-99868449 ACATTCCAAATCAGAGAAATTGG - Intergenic