ID: 1189846412

View in Genome Browser
Species Human (GRCh38)
Location X:45142725-45142747
Sequence CCACAGTGCCTCTTGTAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189846412_1189846418 17 Left 1189846412 X:45142725-45142747 CCTGTCTACAAGAGGCACTGTGG No data
Right 1189846418 X:45142765-45142787 AGGAATTGGAAATGAGCATGTGG No data
1189846412_1189846416 -3 Left 1189846412 X:45142725-45142747 CCTGTCTACAAGAGGCACTGTGG No data
Right 1189846416 X:45142745-45142767 TGGTCTGTGTGTAGAAGGGAAGG No data
1189846412_1189846414 -8 Left 1189846412 X:45142725-45142747 CCTGTCTACAAGAGGCACTGTGG No data
Right 1189846414 X:45142740-45142762 CACTGTGGTCTGTGTGTAGAAGG No data
1189846412_1189846417 3 Left 1189846412 X:45142725-45142747 CCTGTCTACAAGAGGCACTGTGG No data
Right 1189846417 X:45142751-45142773 GTGTGTAGAAGGGAAGGAATTGG No data
1189846412_1189846415 -7 Left 1189846412 X:45142725-45142747 CCTGTCTACAAGAGGCACTGTGG No data
Right 1189846415 X:45142741-45142763 ACTGTGGTCTGTGTGTAGAAGGG No data
1189846412_1189846419 21 Left 1189846412 X:45142725-45142747 CCTGTCTACAAGAGGCACTGTGG No data
Right 1189846419 X:45142769-45142791 ATTGGAAATGAGCATGTGGAAGG No data
1189846412_1189846420 27 Left 1189846412 X:45142725-45142747 CCTGTCTACAAGAGGCACTGTGG No data
Right 1189846420 X:45142775-45142797 AATGAGCATGTGGAAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189846412 Original CRISPR CCACAGTGCCTCTTGTAGAC AGG (reversed) Intergenic
No off target data available for this crispr