ID: 1189846414

View in Genome Browser
Species Human (GRCh38)
Location X:45142740-45142762
Sequence CACTGTGGTCTGTGTGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189846412_1189846414 -8 Left 1189846412 X:45142725-45142747 CCTGTCTACAAGAGGCACTGTGG No data
Right 1189846414 X:45142740-45142762 CACTGTGGTCTGTGTGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189846414 Original CRISPR CACTGTGGTCTGTGTGTAGA AGG Intergenic
No off target data available for this crispr