ID: 1189847758

View in Genome Browser
Species Human (GRCh38)
Location X:45152053-45152075
Sequence CACTAATTAGAATTCCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189847754_1189847758 -7 Left 1189847754 X:45152037-45152059 CCTTGAGGGAGGGCACCACTAAT 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1189847758 X:45152053-45152075 CACTAATTAGAATTCCTGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 108
1189847750_1189847758 4 Left 1189847750 X:45152026-45152048 CCACCAGTGCTCCTTGAGGGAGG 0: 1
1: 0
2: 1
3: 26
4: 225
Right 1189847758 X:45152053-45152075 CACTAATTAGAATTCCTGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 108
1189847753_1189847758 1 Left 1189847753 X:45152029-45152051 CCAGTGCTCCTTGAGGGAGGGCA 0: 1
1: 0
2: 2
3: 16
4: 216
Right 1189847758 X:45152053-45152075 CACTAATTAGAATTCCTGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 108
1189847747_1189847758 8 Left 1189847747 X:45152022-45152044 CCTGCCACCAGTGCTCCTTGAGG 0: 1
1: 0
2: 1
3: 12
4: 180
Right 1189847758 X:45152053-45152075 CACTAATTAGAATTCCTGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 108
1189847746_1189847758 9 Left 1189847746 X:45152021-45152043 CCCTGCCACCAGTGCTCCTTGAG 0: 1
1: 0
2: 0
3: 14
4: 161
Right 1189847758 X:45152053-45152075 CACTAATTAGAATTCCTGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189847758 Original CRISPR CACTAATTAGAATTCCTGGG TGG Intronic
900644671 1:3703476-3703498 CACTAATTAGGATTCCCGCGTGG + Intronic
903668546 1:25022359-25022381 CACTTCTTAGAATCCCTGTGAGG + Intergenic
906085494 1:43129763-43129785 CAGAAGTGAGAATTCCTGGGAGG + Intergenic
907171867 1:52474862-52474884 CACATAATATAATTCCTGGGTGG + Exonic
908152390 1:61315676-61315698 CACTCATTGGAATTCATGGTTGG + Intronic
908403012 1:63788546-63788568 CATTGATTGGAATTACTGGGAGG + Intronic
911227696 1:95325204-95325226 CATGAATTAGAATCCCTGGATGG - Intergenic
911735548 1:101332889-101332911 CAGTAATTAGAATTCTAGGCAGG - Intergenic
922136555 1:222833271-222833293 CACTAATATGAACTCCTGTGAGG - Intergenic
922336644 1:224623673-224623695 CATTAATCAGAATTCTGGGGAGG - Intronic
922482976 1:225951814-225951836 CACTTATTACAATTGGTGGGGGG - Intergenic
922623159 1:227006992-227007014 CACCAAGCAGAATTGCTGGGGGG - Intronic
923483759 1:234409196-234409218 CACTAATTAGCATTCCTTTTTGG + Intronic
923672028 1:236049238-236049260 CACCAATTAGCAGTCCTGGTAGG - Intronic
924666465 1:246078219-246078241 CATTAAATAGAATTTATGGGAGG + Intronic
1066065354 10:31757617-31757639 CACTAATTGCAATTTCTGGTCGG + Intergenic
1066411489 10:35174762-35174784 TACTAATTAGAAAACCTGGCAGG + Intronic
1068072960 10:52218805-52218827 CACTAATTTCATTTCATGGGAGG - Intronic
1071117972 10:82245755-82245777 CAAAAATGAGAATTCCTGTGTGG - Intronic
1071981711 10:91010083-91010105 CACTATTGAGAATACCTTGGAGG - Intergenic
1073981317 10:109156967-109156989 CACTGCTTAGTATTGCTGGGAGG - Intergenic
1074334167 10:112551841-112551863 GGCTTATGAGAATTCCTGGGGGG + Intronic
1074354270 10:112768270-112768292 CAGTAATTACATTTCCAGGGTGG - Intronic
1077930433 11:6725690-6725712 CTGGATTTAGAATTCCTGGGTGG - Intergenic
1078092037 11:8269763-8269785 CTCTCAATAGATTTCCTGGGAGG - Intergenic
1082808849 11:57466550-57466572 AACTATGCAGAATTCCTGGGGGG - Intronic
1083277886 11:61607540-61607562 AACAAATGAGAATTCCTAGGAGG - Intergenic
1085389943 11:76177209-76177231 CACCATTTATAATTCCTTGGGGG - Intergenic
1085531773 11:77196040-77196062 CACTAATGAGATATCTTGGGTGG - Intronic
1087515697 11:99157405-99157427 CACTAATAAAAATTGCTGTGAGG - Intronic
1088896831 11:114084715-114084737 CTCAAGTTAGAAATCCTGGGAGG + Intronic
1094083972 12:26568702-26568724 CATTAATTAGAAAACCTGGTTGG + Intronic
1096693831 12:53336428-53336450 CACTAATTAGAGATCCAGGGGGG + Intronic
1098334207 12:69385259-69385281 AACTATTTAAAATTCCTGGCTGG - Intronic
1101608811 12:106271398-106271420 TACTAATCAGCATTCCTTGGAGG - Intronic
1101863794 12:108504517-108504539 TACTAATTTGTATTCCAGGGTGG - Intergenic
1103189972 12:118992894-118992916 CACTGCTCAGAATTCCTTGGGGG + Intronic
1104355255 12:128079552-128079574 CACTAAGTAGAATTTCATGGAGG - Intergenic
1107058169 13:36129236-36129258 CAATAGTTAGAATTCCCTGGGGG + Intronic
1108993572 13:56695335-56695357 CACTAATTTTAATTCTTTGGAGG - Intergenic
1110147391 13:72208476-72208498 CTCTAATTAGCTTCCCTGGGAGG - Intergenic
1111856671 13:93646563-93646585 CAATAAGTAAAATTGCTGGGGGG - Intronic
1113045056 13:106146621-106146643 CACTATTAAGAATTTCTAGGTGG + Intergenic
1114550680 14:23531199-23531221 CACTACTCAGAATCACTGGGTGG + Intronic
1115361039 14:32503049-32503071 CACTATTAAGTATTCCTGGTTGG - Intronic
1117102021 14:52359256-52359278 CACTAAAGAGGATTCCTTGGAGG + Intergenic
1121679795 14:95783963-95783985 GACCAATTAAAATTCCTGGCTGG + Intergenic
1125922635 15:43534661-43534683 GATAAATTAGAAGTCCTGGGTGG - Exonic
1129838373 15:78727847-78727869 CAGTAATGACAGTTCCTGGGGGG - Intergenic
1130368347 15:83261221-83261243 CACTAATTAGGGTGCCTTGGTGG + Intronic
1135644575 16:24150426-24150448 CCCTAATTCAAATTCTTGGGAGG + Intronic
1138939518 16:61773723-61773745 AGCTAATTTGAATTCCAGGGTGG + Intronic
1143992584 17:10979153-10979175 CACCAAATAGAATTGCTGCGAGG - Intergenic
1144999735 17:19295790-19295812 CTCAAATTAGAATCTCTGGGAGG + Intronic
1148605415 17:48925581-48925603 CAGCAATTAGAATTCCTGATGGG - Intronic
1153606257 18:6836397-6836419 CACCAATTAGGACTCCTGGTGGG - Intronic
1158299778 18:56038302-56038324 CACTAATTAGACTTTTTTGGGGG - Intergenic
1166190999 19:41176522-41176544 CACTAATTTTAATGCCTGGGAGG - Intergenic
1168457929 19:56528732-56528754 AAAGAATTAGAATTCCTGCGGGG + Exonic
928283791 2:29971582-29971604 CACTAGTTGGAAACCCTGGGAGG + Intergenic
929409482 2:41681287-41681309 TCCTAATCAGAATTCCAGGGAGG - Intergenic
929602194 2:43211256-43211278 CACTAAGTATAATACCTCGGAGG - Intergenic
931605864 2:64051505-64051527 CAATAATTAGCATTACAGGGAGG - Intergenic
932856827 2:75242632-75242654 CACTCACTGGAATTCCTGAGAGG + Intergenic
938593381 2:132761992-132762014 CATCATTTAGAATTCTTGGGGGG + Intronic
944897477 2:204179720-204179742 CACTAATTTTAATTACTGTGTGG - Intergenic
944934636 2:204555079-204555101 CACTAATGAGTGTTCCTGGTAGG + Intronic
947312513 2:228819710-228819732 CACTAATTAGGAACACTGGGAGG + Intergenic
1170824590 20:19783018-19783040 CGCTGCTTTGAATTCCTGGGTGG - Intergenic
1172807916 20:37626184-37626206 CACAGATTGGATTTCCTGGGAGG + Intergenic
1174771750 20:53306945-53306967 TACTTCTTAGAATTCCTGTGAGG - Intronic
1175858901 20:62138852-62138874 CATAAATTAAAATTCTTGGGTGG - Intronic
1176667868 21:9704263-9704285 CACGAATGACAATTCCTGGGGGG - Intergenic
1178482354 21:32990597-32990619 CACTAATTAAACTTTGTGGGTGG - Intergenic
1183099187 22:35573432-35573454 CACTAAGTAGAAATGATGGGTGG - Intergenic
952252307 3:31666356-31666378 CCCCAACTAGAATTCCTGGAAGG - Intronic
959188052 3:103072548-103072570 CACTAATAAGAAATCATGGCTGG + Intergenic
961157482 3:124692329-124692351 CACTTTTTAGAAAACCTGGGTGG + Intronic
961945992 3:130689047-130689069 TACTAATTAGAATTTGTGGAAGG - Intronic
963261860 3:143200785-143200807 CAGGAATTAAAAGTCCTGGGTGG - Intergenic
963761709 3:149291712-149291734 CACTAATTCAAATACCTGAGGGG + Intergenic
974841461 4:67304054-67304076 CTGTAATGAGAATTCCTGGGAGG + Intergenic
974847483 4:67368121-67368143 CACTAATTATGATGCCTGGCAGG - Intergenic
984296356 4:177859491-177859513 AACTAATTAGAATTTCTGTAGGG - Intronic
985406934 4:189647337-189647359 CACAAATGACAATTCCTGGGGGG + Intergenic
1001236402 5:170033093-170033115 CACTTATCAGAATTACTGTGAGG + Intronic
1004028928 6:11846995-11847017 CCCTAATTAGAATGCAAGGGTGG - Intergenic
1006773970 6:36577618-36577640 CACTAGTTAGAATTCCAGTCTGG - Intergenic
1011448864 6:87472396-87472418 CATTAGTTAGAATGCCTGGCTGG + Intronic
1011988073 6:93475253-93475275 CATTATTTGGAATTCCTGAGTGG + Intergenic
1012379895 6:98608220-98608242 CACTGGTTAGAATTTCTGGCTGG - Intergenic
1013755441 6:113456205-113456227 CACTAACTAGTATTCCAAGGGGG + Intergenic
1017453670 6:154578211-154578233 CACTAATAAGAATTTCTTGCTGG - Intergenic
1018749085 6:166786972-166786994 CACGAATCAGAATTCCTGGTTGG - Intronic
1023299966 7:38759571-38759593 CTCCATTTAGCATTCCTGGGAGG + Intronic
1026075352 7:67161870-67161892 CACTAATAAGCTTTCCAGGGAGG + Intronic
1026701498 7:72650336-72650358 CACTAATAAGCTTTCCAGGGAGG - Intronic
1030400599 7:109044006-109044028 CAATAACTAGACTTCTTGGGAGG - Intergenic
1030827555 7:114178787-114178809 AACTAATTAAAGATCCTGGGTGG - Intronic
1031542648 7:123013696-123013718 CCCTAAATGGAATTTCTGGGCGG + Intergenic
1033065889 7:138153544-138153566 CACTAATTAGTATTTTTGGTAGG - Intergenic
1033656183 7:143376199-143376221 TACTAATTACAATACCTGGGTGG - Intergenic
1035880245 8:3238734-3238756 CTCTAATTAGATGTCCTGGGTGG - Intronic
1041348756 8:56928428-56928450 CCATAATCAGAATTCCAGGGAGG - Intergenic
1042370077 8:67981481-67981503 CACTAGATAGAAGTCCAGGGAGG + Intronic
1042759351 8:72253766-72253788 CAGTCATGAGAATTCCTGAGAGG - Intergenic
1046033143 8:108807182-108807204 CATTAATCAGTATTCTTGGGTGG - Intergenic
1046529337 8:115422942-115422964 CACCAATTGGCATTCCTGAGGGG + Intronic
1047467678 8:125133900-125133922 CACTAATCAGAATCACTTGGAGG + Intronic
1047607519 8:126489645-126489667 CCCTCATTAGAAATCTTGGGAGG + Intergenic
1049933646 9:479876-479898 CACCAATTATACTTACTGGGGGG - Intronic
1203657946 Un_KI270753v1:16436-16458 CACAAATGACAATTCCTGGGGGG + Intergenic
1187432137 X:19234794-19234816 CATGAATCAGAATCCCTGGGAGG + Intergenic
1188569609 X:31567283-31567305 CCCTAATTAGCAATCATGGGTGG + Intronic
1189847758 X:45152053-45152075 CACTAATTAGAATTCCTGGGTGG + Intronic
1196819305 X:119690426-119690448 CATTAAAAAGAATTCCTGGCCGG + Intronic
1197158244 X:123293550-123293572 GAGTCATTAGAATTCATGGGTGG + Intronic
1202303565 Y:23443646-23443668 CAAGAATTAGAATACCAGGGAGG + Intergenic
1202567245 Y:26226948-26226970 CAAGAATTAGAATACCAGGGAGG - Intergenic