ID: 1189849226

View in Genome Browser
Species Human (GRCh38)
Location X:45162474-45162496
Sequence AAAGGTCTCACTCTGTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 373}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189849226_1189849228 -7 Left 1189849226 X:45162474-45162496 CCCACTTACAGAGTGAGACCTTT 0: 1
1: 0
2: 1
3: 17
4: 373
Right 1189849228 X:45162490-45162512 GACCTTTGTCTACTTCTGTTTGG 0: 1
1: 0
2: 3
3: 17
4: 160
1189849226_1189849232 30 Left 1189849226 X:45162474-45162496 CCCACTTACAGAGTGAGACCTTT 0: 1
1: 0
2: 1
3: 17
4: 373
Right 1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG 0: 1
1: 0
2: 1
3: 9
4: 124
1189849226_1189849230 3 Left 1189849226 X:45162474-45162496 CCCACTTACAGAGTGAGACCTTT 0: 1
1: 0
2: 1
3: 17
4: 373
Right 1189849230 X:45162500-45162522 TACTTCTGTTTGGCATGTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189849226 Original CRISPR AAAGGTCTCACTCTGTAAGT GGG (reversed) Intronic
903512963 1:23890232-23890254 CAAGGTCTCACTCTGTAGCCCGG - Intronic
904552985 1:31336687-31336709 CAAGGTCTCACTCTGTCACCTGG + Intronic
906927245 1:50131342-50131364 AAAGGTCACACTCACTAATTGGG - Intronic
907529740 1:55082773-55082795 CAAGGTCTCACTCTGTCACCAGG - Intronic
909240180 1:73203170-73203192 GAAGGTCTCACTCTGTCAACAGG + Intergenic
911764614 1:101658573-101658595 TCAGGTGTCACTGTGTAAGTAGG - Intergenic
913019617 1:114775526-114775548 CAGGGTCTCACTCTGTCACTCGG + Intronic
913789734 1:122503962-122503984 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913796802 1:122630109-122630131 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913797527 1:122643029-122643051 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913798244 1:122655943-122655965 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913804897 1:122776637-122776659 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913814411 1:122947322-122947344 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913815438 1:122965675-122965697 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913835545 1:123325421-123325443 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913854706 1:123669538-123669560 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913869427 1:123933618-123933640 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913890719 1:124314707-124314729 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913891437 1:124327967-124327989 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913900529 1:124490285-124490307 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913904666 1:124565040-124565062 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913905703 1:124583742-124583764 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913908326 1:124630646-124630668 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913908655 1:124636426-124636448 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913911779 1:124692518-124692540 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
913930408 1:124954592-124954614 AAATGTTCAACTCTGTAAGTTGG + Intergenic
913935945 1:125046980-125047002 AAAGGTTGAACTCTGTTAGTTGG - Intergenic
914705684 1:150167821-150167843 CAAGGTCTCACTCTGTCACAAGG - Intergenic
915372647 1:155364236-155364258 CAAGGTCTCACTCTGTCACCAGG - Intronic
915407130 1:155668886-155668908 CAAGGTCTCACTCTGTCACCTGG + Intronic
915680494 1:157577354-157577376 AAAGATCTCAATTTGTTAGTGGG + Intronic
915801542 1:158798786-158798808 AAATGTCTTACTCTGATAGTGGG + Intergenic
916685760 1:167144185-167144207 AAGGGTCTCACTCTGTCATCTGG + Intergenic
916992112 1:170255422-170255444 AAAGGTCTCACTCTGTCACCTGG + Intergenic
917543612 1:175938983-175939005 AGAGGTCTCAGGCTGGAAGTAGG - Intergenic
917638729 1:176961568-176961590 CAAGGTCACCCTCTGTAAATGGG + Intronic
917988449 1:180346989-180347011 CAAGGTCTCACTCTGTCACCCGG - Intronic
918716548 1:187795324-187795346 TAAGATCTAACTTTGTAAGTGGG - Intergenic
919688296 1:200505107-200505129 CAAGGTCTCACTCTGTCACCTGG - Intergenic
920063865 1:203250265-203250287 CAAGGTCTCACTCTGTCACCAGG - Intronic
920287474 1:204890940-204890962 AATGGTCTCACCCTGGTAGTGGG + Intronic
923218744 1:231874181-231874203 AAAAGTCTCACTCTGTCACCAGG + Intronic
923685604 1:236151324-236151346 AATGGTTTTACTCTGCAAGTGGG + Intronic
924038482 1:239959284-239959306 CAAGGTCTCACTTTGTTACTGGG - Intergenic
1063445164 10:6108907-6108929 AAAGGTCTCTCTCTGCAGGAGGG - Intronic
1063873488 10:10445748-10445770 AAAAGTCTTCCTCTGGAAGTAGG + Intergenic
1064417446 10:15162225-15162247 CAAGGTCTCACTCTGTCATCTGG - Intronic
1065510924 10:26477754-26477776 CAAGGTCTCACTCTGTCACCTGG + Intronic
1065936733 10:30527171-30527193 AAAAGTCTCGCTCTGTCAGCAGG + Intergenic
1066431151 10:35352948-35352970 TAGGGTCTCACTCTGTAACCTGG + Intronic
1066790119 10:39053047-39053069 AAAGGTTTAACTCTGTGAGATGG - Intergenic
1066794527 10:39104640-39104662 AAAGGTTTAACTCTGTGAGATGG - Intergenic
1066806226 10:39257749-39257771 AAAAGTTTAACTCTGTAAGATGG + Intergenic
1066809054 10:39301188-39301210 AAAGGTTTAATTCTGTAAGATGG + Intergenic
1066823978 10:39538982-39539004 AAAGGTTTAACACTGTGAGTTGG - Intergenic
1066824228 10:39544081-39544103 AAAGGTTCAACTCTGTGAGTTGG - Intergenic
1066825309 10:39565092-39565114 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
1067034002 10:42899746-42899768 CAAGGTCTCACTCTGTGACCAGG + Intergenic
1067485915 10:46649921-46649943 AAAGGTCTAACTCTGTTGCTCGG + Intergenic
1067608841 10:47691732-47691754 AAAGGTCTAACTCTGTTGCTTGG - Intergenic
1068217029 10:53994973-53994995 AGTGGGCTCACACTGTAAGTTGG - Intronic
1070492188 10:76987874-76987896 AAAGGTCTCTCTCTTTAAAATGG + Intronic
1071624425 10:87153379-87153401 AAAGGTCTAACTCTGTTGCTCGG - Intronic
1071859771 10:89660512-89660534 AAGGGTCTGACTCTCTCAGTGGG - Intergenic
1072259590 10:93656592-93656614 ACAGGTCTCACTCTGTCACCTGG + Intronic
1072507571 10:96084113-96084135 CAAGGTCTCACTCTGTCACCAGG + Intergenic
1073303739 10:102486808-102486830 CAAGGTCTCACTCTGTCACCAGG + Intronic
1073451010 10:103609129-103609151 CAGAGTCTCACTCTGTCAGTTGG - Intronic
1073997145 10:109328567-109328589 CAAGGTCTCACTCTGTTGGCAGG + Intergenic
1074632732 10:115275915-115275937 AAAGGGCTCTTTCTGTTAGTTGG - Intronic
1075130713 10:119736582-119736604 AAAGGTCCCACAGTGTAATTAGG - Intronic
1076481548 10:130788391-130788413 AGAAGTCTCAGTCTGTATGTGGG + Intergenic
1078472438 11:11602317-11602339 AAAGCTTCCACCCTGTAAGTAGG + Intronic
1079012040 11:16836537-16836559 AAAGCTCCATCTCTGTAAGTGGG - Intronic
1079439116 11:20491833-20491855 AAAGATCTAATTCTGTATGTAGG - Intronic
1079812215 11:25008906-25008928 GAAGTTCTCACTCTGGTAGTAGG + Intronic
1082154792 11:48794850-48794872 AAAGGTTCAACTCTGTGAGTTGG + Intergenic
1082165102 11:48939234-48939256 AAAGGTTCAACTCTGTGAGTTGG + Intergenic
1082594757 11:55063767-55063789 AAAGGTTTAACTGTGTAAGACGG - Intergenic
1084988619 11:72901370-72901392 CAGGGTCTCACTCTGTCACTGGG - Intronic
1086346098 11:85898406-85898428 AAAAGTCTTACTTTGTCAGTAGG - Intronic
1087747883 11:101970998-101971020 AAGGGTCTCACTCTGTCACCCGG + Intronic
1087893785 11:103564884-103564906 AATGGGCTTACTCTTTAAGTAGG + Intergenic
1088020471 11:105112156-105112178 AAAGGTCTCACCCAGTCAGCAGG - Intergenic
1089430474 11:118419908-118419930 ATAGGTCTCACTCTGTCACCAGG - Intronic
1089743496 11:120601027-120601049 CAAGGTCTCACTCTGTCACCAGG - Intronic
1090336226 11:125968326-125968348 AAAAATCTCATTCTGTAACTTGG - Intronic
1090516491 11:127433720-127433742 AAAGATCTCAGTGAGTAAGTAGG - Intergenic
1091024973 11:132134037-132134059 AACAGTCTCACTCTGTAGCTGGG + Intronic
1091092538 11:132785811-132785833 TGAGGTCTCCCTCTGTAGGTTGG - Intronic
1091649650 12:2300598-2300620 GAAGGTCTCACTCTGTCACCAGG - Intronic
1091907070 12:4197479-4197501 CAGGGTCTCACTCTGTCACTCGG - Intergenic
1094694917 12:32808980-32809002 AAAGGTCTCACCCAGTCAGGAGG + Intronic
1094868429 12:34569025-34569047 AAAGGTTTAACTCTGTGAGATGG + Intergenic
1095047848 12:37529892-37529914 AAAGTTGTAACTCTGTTAGTTGG + Intergenic
1095071093 12:37848368-37848390 ACAGGTTTAACTCTGTGAGTTGG + Intergenic
1095593639 12:43935030-43935052 CAAGGTCTCACTCTGTCACCCGG + Intronic
1097367165 12:58729647-58729669 CAAGGTCTCACTCTGTTGGAGGG - Intronic
1097419106 12:59351976-59351998 CAAGGTCTCACTCTGTTACCTGG - Intergenic
1097691075 12:62735229-62735251 CAAGGTCTCACTCTTTACCTAGG + Intronic
1098355506 12:69609336-69609358 CAAGGTCTCACTCTGTTGCTAGG - Exonic
1098587129 12:72167093-72167115 AAAGGTCTCACTCTGAGACATGG + Intronic
1101054569 12:100899062-100899084 AGAGGTCTCTCTCTATAAGTAGG - Intronic
1102740010 12:115198823-115198845 AAAGTTCTCTCCCTGAAAGTTGG + Intergenic
1102982539 12:117253555-117253577 GAAGCGCTCACTTTGTAAGTAGG + Intronic
1104316075 12:127702906-127702928 AAAGGTCTCATTATGTTTGTTGG - Intergenic
1104816797 12:131651222-131651244 AAAGATCTCACTCATTAATTAGG - Intergenic
1105088146 13:16236348-16236370 AAAGGTTCAACTCTGTGAGTTGG - Intergenic
1105169211 13:17562466-17562488 AAAGGTTCCACTCTGTTAGCTGG - Intergenic
1105728493 13:23188075-23188097 AAAGCTGTCATTCTGTAAATGGG + Intronic
1111262766 13:85763298-85763320 AGAGATCTCACTCTGTTAATAGG - Intergenic
1111481914 13:88840325-88840347 CAGGGTCTCACTCTGTCAGCCGG - Intergenic
1112893324 13:104265819-104265841 AAAGGTCTCAATGGGTAAGCAGG - Intergenic
1115655746 14:35442088-35442110 CAGGGTCTCACTCTGTAACCCGG + Intergenic
1116184560 14:41580975-41580997 AAATCTCTCTCTCTGTATGTAGG + Intergenic
1117157634 14:52956668-52956690 CAAGGTCTCACTCTGTCACCTGG + Intergenic
1118133971 14:63001048-63001070 CAAGGTCTCACTCTGTTGCTTGG - Intronic
1119354389 14:73993309-73993331 CAGGGTCTCACTCTGTACCTAGG - Intronic
1119463987 14:74839007-74839029 CAAGGTCTCACTCTGTTGGCTGG + Intronic
1119585214 14:75827743-75827765 CAAGGTCTCACTCTGTCACCAGG + Intronic
1119790500 14:77345632-77345654 AAAGGTCTCACTCTGTCACCCGG - Intronic
1119947310 14:78708519-78708541 AAAAGTCTAACACTGTAAGAGGG + Intronic
1120022845 14:79549993-79550015 AGAGGTCTCACTCTGTCACCAGG + Intronic
1124351636 15:28960122-28960144 CAAGGTCTCACTCTGTCACCTGG - Intronic
1125258455 15:37794256-37794278 AAAGGTGTCACTCTGTTTATAGG - Intergenic
1125495354 15:40187874-40187896 CAAGGTCTCACTCTGTACTCAGG - Intronic
1125811373 15:42544485-42544507 CAAGGTCTCACTCTGTCACCTGG - Intronic
1126054787 15:44719978-44720000 CAAGGTCTCACTCTGTCACCCGG + Intergenic
1127362427 15:58256192-58256214 CAATGTCCCACTCTGAAAGTGGG + Intronic
1128139772 15:65290961-65290983 CAAGGTCTCACTCTGTCACCAGG + Intronic
1129783820 15:78294257-78294279 AAAGCTCTTGCTCTCTAAGTAGG - Intronic
1129810302 15:78504978-78505000 CAGGGTCTCACTCTGTCACTCGG - Intergenic
1131118706 15:89809765-89809787 TAAGGTTTCACTCTGCAGGTTGG - Intronic
1131876767 15:96815969-96815991 CAGGGTCTCACTCTGTCAGCAGG + Intergenic
1132098323 15:99004935-99004957 GAAGTTCTTACTCTGGAAGTGGG + Intronic
1132108587 15:99085202-99085224 AAAGGTCTCACTCTGTCACTAGG - Intergenic
1133037668 16:3043330-3043352 CAGGGTCTCACTCTGTCACTTGG + Intergenic
1133055875 16:3145284-3145306 GAAGGTCTCACTGTGTAGTTGGG + Intronic
1133182072 16:4064495-4064517 CAGGGTCTCACTCTGTCACTCGG + Intronic
1133704699 16:8342656-8342678 AATGGAGTCACTCTATAAGTGGG + Intergenic
1133846477 16:9458594-9458616 CAGGGTCTCACTCTGTCTGTTGG - Intergenic
1134336471 16:13304281-13304303 AAGGGTCTCACTCTGTCACCTGG + Intergenic
1134416774 16:14050386-14050408 CAAGGTCTCACTCTGTCACCTGG + Intergenic
1134619496 16:15676850-15676872 CCAGGTCTCACTCTGTGAGCCGG + Intronic
1134809254 16:17153289-17153311 CAAGGTCACACACTGTGAGTGGG + Intronic
1136468130 16:30459233-30459255 CAAGGTCTCATTCTGTCACTCGG + Intergenic
1136745292 16:32582846-32582868 AAAGGTTTAACTCTGTGAGATGG - Intergenic
1136745469 16:32585946-32585968 AAAGGTTTAACTCTGTGAGATGG - Intergenic
1137059716 16:35779487-35779509 AAAGGTTTAACTCTGTGAGATGG + Intergenic
1137132592 16:36907813-36907835 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
1138112962 16:54339177-54339199 CAGGGTCTCACTCTGTCACTCGG + Intergenic
1141477645 16:84284362-84284384 CAAGGTCTGACTCTCTAAGAGGG + Intergenic
1141957174 16:87380424-87380446 AAGGGTCTCACTCTGTCACCCGG + Intronic
1203012345 16_KI270728v1_random:308160-308182 AAAGGTTTAACTCTGTGAGATGG - Intergenic
1203030680 16_KI270728v1_random:581319-581341 AAAGGTTTAACTCTGTGAGATGG - Intergenic
1203041041 16_KI270728v1_random:753112-753134 AAAGGTTTAACTCTGTGAGATGG + Intergenic
1203047419 16_KI270728v1_random:842050-842072 AAAGGTTTAACTCTGTGAGATGG - Intergenic
1203047595 16_KI270728v1_random:845151-845173 AAAGGTTTAACTCTGTGAGATGG - Intergenic
1142989572 17:3721294-3721316 CAAGGTCTCACTCTGTTACTCGG + Intronic
1143091303 17:4450437-4450459 CAAGGTCTCACTCTGTCACCAGG + Intronic
1145083324 17:19914023-19914045 CATGGTCTCACTCTGTCACTAGG + Intronic
1145365520 17:22262468-22262490 AAAGGTGTAACTCTGTGAGATGG + Intergenic
1145685184 17:26649565-26649587 AAAAGTTCCACTCTGTTAGTTGG - Intergenic
1146012129 17:29204575-29204597 TAAGGTCTCACTCTGTACTCAGG + Intergenic
1146028302 17:29342366-29342388 GAAGGTCTCACTCTGTCACCCGG + Intergenic
1148935691 17:51163206-51163228 ACAGGTCTCACTCTGTCACCCGG - Intronic
1150675493 17:67243654-67243676 AAATGTATCACTCAGTCAGTGGG - Intronic
1150897095 17:69224551-69224573 AAAGGTCTCACATAGTAAGTAGG + Intronic
1151331184 17:73409877-73409899 CAGGGTCTCACTCTGTCACTCGG + Intronic
1151536474 17:74741730-74741752 AAAGGTCTCACCCTGGCAGGTGG + Intronic
1154230071 18:12548634-12548656 CAAGGTCTCACTCTGTCACCCGG + Intronic
1154973711 18:21436441-21436463 CAAGGTCTCACTTTGTAACCTGG - Intronic
1156728187 18:40155792-40155814 TAAAGTCTCACTCTGTGACTCGG - Intergenic
1156801921 18:41125923-41125945 ATAGTTCCCACTCAGTAAGTGGG - Intergenic
1158353647 18:56591984-56592006 AAAGGTCTCAATCCTTAAGTGGG - Intergenic
1161529638 19:4780126-4780148 TAGGGTCTCACTCTGTAGCTTGG + Intergenic
1162098330 19:8324262-8324284 CAGGGTCTCACTCTGTAACCCGG - Intronic
1164331419 19:24261796-24261818 AAAAGTTTAACTCTGTGAGTAGG + Intergenic
1164364715 19:27564470-27564492 AAAGGTTTAACTCTGTGAGAAGG - Intergenic
1164380215 19:27729377-27729399 AAACGTTTAACTCTGTAAGATGG + Intergenic
1165521710 19:36319498-36319520 CAGGGTCTCACTCTGTCAGCCGG - Intergenic
1166740449 19:45111663-45111685 AATGTTCTCACTCTGAAATTAGG - Intronic
1166883561 19:45943749-45943771 TAGGGTCTCACTGTGTCAGTTGG - Intronic
1167177463 19:47875134-47875156 CAAGGTCTCACTCTGTCACCAGG - Intronic
1167782669 19:51609951-51609973 CAAGGTCTCACTCTATCACTCGG + Intergenic
927750652 2:25667174-25667196 AAAGCACTCACTCTGAAAATGGG + Intronic
928528550 2:32166342-32166364 AGACGTCTCACTCTGCAACTTGG + Intronic
929271471 2:39976998-39977020 AAAGGTCTCTCTGAGGAAGTTGG + Intergenic
929602814 2:43215191-43215213 CAAGGTCTCACTCTGTTACTTGG + Intergenic
931175665 2:59851987-59852009 GGAGTTCACACTCTGTAAGTAGG - Intergenic
932126664 2:69150997-69151019 CAGGGTCTCACTCTGTCACTTGG - Intronic
932519343 2:72393118-72393140 CAAAGTCTCACTCTGTAACCAGG + Intronic
933710907 2:85325500-85325522 CAAGGTCTCACTCTGTCACCCGG + Intronic
933733657 2:85477629-85477651 CAAGGTCTCACTCTGTCACCTGG - Intergenic
934121236 2:88841874-88841896 TAATGTCACACTCTGTGAGTTGG + Intergenic
934495464 2:94792915-94792937 CAAGGTCTCACTCTGTCACCAGG - Intergenic
935050674 2:99522510-99522532 AAAACTCTTAGTCTGTAAGTGGG - Intergenic
937953521 2:127406330-127406352 AAGGGTCTCACTCTGTGGGCTGG - Intergenic
937979061 2:127602623-127602645 CAGGGTCTCACTCTGTCATTTGG - Intronic
938535886 2:132246012-132246034 AAAGGTTCAACTCTGTGAGTTGG - Intronic
939939648 2:148334356-148334378 CAAGGTCTCATTCTGTCACTGGG + Intronic
940452530 2:153857886-153857908 ATAAGTCTTACTCTGAAAGTTGG - Intergenic
942857331 2:180565034-180565056 CAAGGTCTCACTCTGTCACCTGG + Intergenic
943821723 2:192331519-192331541 AAAGTTCTTACTGTGAAAGTTGG + Intergenic
944328411 2:198435382-198435404 AAAAGTCTCAATCTCTTAGTGGG + Intronic
944582300 2:201142248-201142270 CAAGGTCTCACTCTGTCACCAGG - Intronic
947111553 2:226724327-226724349 AAGGGTCTCACTCTGTCACCAGG + Intergenic
947678534 2:232008029-232008051 CAGGGTCTCACTCTGTCACTTGG + Intronic
948149075 2:235730504-235730526 CAAGGTCTCACTCTGTCACCTGG + Intronic
948979644 2:241486435-241486457 CGAGGTCTCACTCTGTCACTGGG - Intronic
949012942 2:241692021-241692043 CAAGGTCTCACTCTGTCACCTGG - Intergenic
1169287938 20:4325237-4325259 AGAGGTCTTTCCCTGTAAGTAGG + Intergenic
1170669328 20:18416146-18416168 CAAGCTCTCCCTCTGTAAGATGG - Intronic
1170948415 20:20912315-20912337 CAAGGTCTCACTCTGTCACCAGG + Intergenic
1171542397 20:25973388-25973410 AAAGTTTTAACTCTGTGAGTTGG + Intergenic
1171798655 20:29587152-29587174 AAAGTTTTAACTCTGTGAGTTGG - Intergenic
1171845438 20:30270027-30270049 AAAGTTTTAACTCTGTGAGTTGG + Intergenic
1171886636 20:30657849-30657871 CAAGGTCTCACTCTGTCACCAGG - Intergenic
1171911840 20:30969428-30969450 AAAGGTTCAACTCTGTAGGTTGG + Intergenic
1172233204 20:33351108-33351130 CAAGGTCTCACTCTGTCACCGGG + Intergenic
1172577363 20:36019495-36019517 CAAGGTCTCACTCTGTCCCTAGG - Intronic
1172609924 20:36242880-36242902 CAAGGTCTCACTCTGTGACATGG + Intronic
1172834909 20:37867032-37867054 AAGGGTCTTTCTCTGTAAGTGGG + Intronic
1173093595 20:40001785-40001807 AATGGTCTCAGTCTATGAGTGGG + Intergenic
1173196870 20:40921539-40921561 CAAGGTCTCACTCTGTCATCTGG - Intergenic
1173517258 20:43673611-43673633 CAGGGTCTCACTCTGTCACTGGG - Intronic
1174800435 20:53558755-53558777 GAGGGTCTCACTCTGTCACTGGG - Intergenic
1177535699 21:22424063-22424085 GAAGATATCCCTCTGTAAGTCGG + Intergenic
1178078606 21:29037609-29037631 CAGGGTCTCACTCTGTCACTCGG + Intronic
1179296295 21:40065820-40065842 ACAGGTATCACTCAGTAAGATGG - Intronic
1180503237 22:15959198-15959220 AAAGGTTCAACTCTGTTAGTTGG + Intergenic
1181595597 22:23912532-23912554 AAATGTCCCAGTCTGTAAGTGGG + Intergenic
1182097538 22:27636256-27636278 AAAGAGCTCACACTTTAAGTAGG + Intergenic
1185321952 22:50205538-50205560 CAGGGTCTCACTCTGTCACTTGG - Intronic
1203335338 22_KI270739v1_random:63314-63336 AAAGGTTCAACTCTGTTAGTTGG - Intergenic
949817848 3:8079361-8079383 ACAGCTGTCACTGTGTAAGTGGG + Intergenic
949966484 3:9361125-9361147 CAAGGTCTCACTCTGTCACCTGG + Intronic
950904414 3:16524821-16524843 AGAGGACTCACCCTGTAAGAGGG + Intergenic
952348134 3:32507877-32507899 CAAGGTCTCACTCTGTCACCTGG - Intergenic
953157733 3:40390227-40390249 CAAGGTCTCACTCTGTCACCAGG + Intronic
953264146 3:41369928-41369950 AAAGGTTGCACTCTATGAGTGGG - Intronic
956182410 3:66529728-66529750 CAGGGTCTCACTCTGTCAGCAGG - Intergenic
958206700 3:90407532-90407554 AAAGGTTTAACTCTGTGAGTTGG + Intergenic
958746806 3:98145875-98145897 AAAAGAGTCACTCTGTGAGTAGG - Intergenic
958758744 3:98281570-98281592 AAAGGAGTCACTTTGTGAGTAGG - Intergenic
958916717 3:100058311-100058333 CAAAGTTTCATTCTGTAAGTAGG - Intronic
959516488 3:107272967-107272989 CAAGGTCTCACTCTGTCACCTGG + Intergenic
962000149 3:131287296-131287318 CAAGGTCTCACTCTGTCATCCGG + Intronic
962799434 3:138877727-138877749 CAAGGTCTCACTCTGTTGCTCGG + Intergenic
962860333 3:139393892-139393914 AGAGGTGTCTCACTGTAAGTGGG + Intergenic
965620931 3:170641723-170641745 AAAGGTGTCACTCTCTCAGGAGG + Intronic
965761699 3:172084423-172084445 CAAGGTCTCACTCTGTCACCAGG - Intronic
966183820 3:177210738-177210760 AAGGGTCTCATTCTATAACTCGG + Intergenic
966356644 3:179086929-179086951 CAGGGTCTCACTCTGTCATTGGG - Intergenic
967483813 3:190006700-190006722 AAAGGACTCACTGAGAAAGTAGG + Intronic
967528519 3:190522111-190522133 CACTGTCTCACTCTGTAATTGGG - Intronic
970165939 4:13238267-13238289 AAAGCTCTAACTCATTAAGTAGG + Intergenic
970493700 4:16603891-16603913 AAGGGTCTCACTCTGTCACCTGG + Intronic
970671520 4:18401984-18402006 TAAGGTCTCACTAAGGAAGTTGG + Intergenic
970964556 4:21913312-21913334 CAAGGTCTCACTCTGTCACCAGG - Intronic
971189698 4:24415547-24415569 AAAGGTCTGCTTTTGTAAGTGGG - Intergenic
972393876 4:38640721-38640743 CAGGGTCTCACTCTGTCACTCGG + Intergenic
973523815 4:51681222-51681244 AAAGGTTCAACTCTGTTAGTTGG - Intergenic
973526754 4:51729186-51729208 AAAGGTTCAACTCTGTTAGTTGG - Intergenic
974089108 4:57292046-57292068 GAAGGCCTCACTCTCTATGTTGG + Intergenic
974271313 4:59654746-59654768 TAAGGTCTTACTGTTTAAGTAGG - Intergenic
974339999 4:60603293-60603315 AGAGGTCTCACCCAGTCAGTAGG + Intergenic
974880205 4:67746982-67747004 AAAAGTCTCACTTTGTAATGTGG - Intronic
976134475 4:81921024-81921046 AATGGGATCACTCTGTAAATGGG + Intronic
977148926 4:93483843-93483865 AAAGGTCTGACTCTGAAGTTGGG - Intronic
978577636 4:110202261-110202283 CAAGGTCTCACTCTGTCATTCGG - Intergenic
980240696 4:130170799-130170821 AAAGGTCTTACTGTCTCAGTCGG + Intergenic
981201052 4:141979855-141979877 AAAGGACTCACTTTCTAAGAAGG - Intergenic
981807660 4:148735351-148735373 CAAGGTCTCACTCTGTCATGAGG - Intergenic
982026764 4:151259122-151259144 CAAGGTCTCACTCTGTTACCTGG - Intronic
985393997 4:189522074-189522096 CATGTTCTCACTTTGTAAGTGGG - Intergenic
985883100 5:2655707-2655729 AAAATGCTCCCTCTGTAAGTAGG + Intergenic
986452121 5:7876684-7876706 CAAGATCTCAGTCAGTAAGTGGG - Intronic
988682374 5:33496393-33496415 GAGGGTCCCACTCTGTAACTGGG - Intergenic
988720638 5:33875040-33875062 ATATGTCTCACTCTGTCAGTAGG - Intronic
989478073 5:41897050-41897072 CAAGGTCTCACTCTATGTGTAGG + Intergenic
991041506 5:62180767-62180789 CAAGGTCTCACTCTGTCACCTGG + Intergenic
991570347 5:68047251-68047273 AATGCTCTTACACTGTAAGTGGG + Intergenic
992684755 5:79188427-79188449 GGAGGTGTCACTCTGTCAGTGGG - Intronic
994451361 5:99949187-99949209 AAAGGTCTCACACATTCAGTTGG - Intergenic
995873907 5:116770301-116770323 CAAGGTCTCACTCTGTCACTTGG - Intergenic
996106524 5:119510946-119510968 AAAGTCTCCACTCTGTAAGTGGG - Intronic
996807175 5:127468938-127468960 CAGGGTCTCACTCTGTCACTAGG + Intergenic
997604604 5:135165332-135165354 AATGTTCTCACTCATTAAGTGGG - Intronic
998527118 5:142852761-142852783 CATGATCTCACTCAGTAAGTTGG + Intronic
1000107692 5:158076022-158076044 AATGGTCTCCCGCTGTAAGACGG + Intergenic
1002477921 5:179479695-179479717 GACAGTCTCACTCTGTAACTTGG - Intergenic
1002988425 6:2214703-2214725 CAAGGTCTCACTATGTTGGTTGG + Intronic
1003208425 6:4036543-4036565 CAAGTTCTCACTCTGTCACTTGG + Intronic
1003669406 6:8142327-8142349 CAAGGTCTCACTCTGTCGCTCGG + Intergenic
1005042785 6:21614542-21614564 AAAATTCAAACTCTGTAAGTAGG + Intergenic
1005625247 6:27656320-27656342 AAAGGTCTCACACTGTCACCAGG - Intergenic
1008186409 6:48396661-48396683 AAAAATATCACTCTATAAGTAGG + Intergenic
1009063247 6:58422683-58422705 AAAGGTATAACTCTGTGAGATGG + Intergenic
1009250915 6:61297242-61297264 AAAGGTATAACTCTGTGAGATGG + Intergenic
1009255372 6:61385676-61385698 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
1011025069 6:82859523-82859545 ATAGCTCTTACTCTGTGAGTTGG - Intergenic
1011035505 6:82969581-82969603 GAGGGTCTCACTCTGTCACTCGG - Intronic
1011615092 6:89190816-89190838 AAAGGTCTTACTGTGTTAATAGG + Intronic
1014064728 6:117111231-117111253 ATAGGTCTCACTCAGTTAGGTGG - Intergenic
1014359310 6:120456433-120456455 CAGGGTCTCACTCTGTCACTGGG + Intergenic
1014597828 6:123367720-123367742 AAAGGTCTGATTCAGTATGTCGG + Intronic
1014654812 6:124088382-124088404 CATGGTCTCACTCTGTTGGTTGG - Intronic
1017067212 6:150540138-150540160 AAATGCCTCACTCTGTGACTTGG + Intergenic
1017858578 6:158374260-158374282 CAAGGTCTCACTCTGTCATTCGG - Intronic
1018212725 6:161497604-161497626 AAAGTATTCAGTCTGTAAGTGGG - Intronic
1018505258 6:164460557-164460579 CAAGGTCTCACTCTGTCACCAGG - Intergenic
1019792366 7:3024438-3024460 CAAGGTCTCACTCTGTTGCTTGG + Intronic
1019814224 7:3187937-3187959 CGAGGTCTCACTCTGTTACTCGG + Intergenic
1020404606 7:7817836-7817858 CAAGGTCTCACTCTGTCACCTGG + Intronic
1023315112 7:38928382-38928404 AAAGGCCTCACACTGTACTTCGG - Intronic
1024741551 7:52360380-52360402 AAAGGTCTCACTATGTTTCTAGG + Intergenic
1025293844 7:57759693-57759715 AAAGTTTTAACTCTGTGAGTTGG + Intergenic
1025459712 7:60594027-60594049 AAAGGTTAAACTCTGTGAGTTGG - Intergenic
1025523605 7:61774901-61774923 AAAGGTTTAACTCTGTGAGATGG + Intergenic
1025578654 7:62681690-62681712 AAAGGTTTAACTCTGTGAGATGG - Intergenic
1025584186 7:62761167-62761189 AAAGGTTTAACTCTGTGAGATGG + Intergenic
1026298831 7:69079480-69079502 AAAGGTCTCACTCACAAAGCAGG + Intergenic
1026580729 7:71614592-71614614 AAAGGTCTCACTCTGTCACCAGG - Intronic
1027740677 7:82000231-82000253 ATGGGTCTCACTCTGTCACTAGG - Intronic
1028406421 7:90479885-90479907 AAAGGGCACACTCTGGTAGTTGG + Intronic
1028855730 7:95590960-95590982 CAGGGTCTCACTCTGTCACTTGG + Intronic
1029158495 7:98534344-98534366 AAGTGTCTCACTCTGTCAGCTGG + Intergenic
1030088180 7:105835177-105835199 AAGGGTCTCACTCTGTCACCTGG + Intronic
1031024542 7:116665824-116665846 AAGGGTCGCACTCAGAAAGTTGG - Intergenic
1031606425 7:123773683-123773705 AAAGGTCTGACTCAATGAGTTGG - Intergenic
1032059278 7:128710440-128710462 TAAGGACTCAATCTGTATGTTGG + Intronic
1034315870 7:150132639-150132661 AAAGCTCACACACTGTCAGTGGG + Intergenic
1034791021 7:153968162-153968184 AAAGCTCACACACTGTCAGTGGG - Intronic
1035950833 8:4018807-4018829 CAAGGTCCCACGCTGTATGTGGG - Intronic
1037011032 8:13842559-13842581 AAACGTCTCACTTTGAAAGCTGG + Intergenic
1037105412 8:15100949-15100971 CATGGTCTCACTCTGTCAGCTGG - Intronic
1038076826 8:24085261-24085283 CAGGGTCTCACTCTGTCACTCGG + Intergenic
1038641560 8:29333215-29333237 AATGGTATCACTCTGAAAGATGG + Exonic
1039429243 8:37512709-37512731 AAATGTATCAGTCTGCAAGTCGG + Intergenic
1040113328 8:43585090-43585112 AAAGGTTTAACTCTGTGAGATGG - Intergenic
1040131404 8:43801200-43801222 AAAGGTTTATCTCTGTAAGATGG - Intergenic
1040132247 8:43810842-43810864 AAAGGTTTAACTCTGTGAGAGGG - Intergenic
1040164204 8:44314623-44314645 AAAGGTTCAACTCTGTTAGTGGG - Intergenic
1040182081 8:44579292-44579314 AAAGGTTCAACTCTGTTAGTGGG - Intergenic
1040250048 8:45583720-45583742 AAAGGTTCAACTCTGTTAGTGGG - Intergenic
1040274961 8:46006581-46006603 AAAAGTTTCACTCTGTGAGATGG - Intergenic
1040321072 8:46303264-46303286 AAAGGTTTAACTCTGTGAGCTGG + Intergenic
1043266100 8:78269196-78269218 AAAGGTCACCCCATGTAAGTGGG + Intergenic
1044303540 8:90611909-90611931 AAAAGTCTCTCTGTGTAAGGTGG + Intergenic
1045431945 8:102123224-102123246 CAAGGTCTCACTCTCTCAGAAGG - Intronic
1047245080 8:123135380-123135402 AAAGGTCTGACTTTTTAAGTGGG - Intronic
1047950172 8:129925968-129925990 AAAGGTTTCATTCAGAAAGTTGG - Intronic
1051014378 9:12457953-12457975 AAAGGTCTCACTGTGTGGTTGGG + Intergenic
1053711734 9:40818515-40818537 AAAGGTTCAACTCTGTGAGTTGG - Intergenic
1053950381 9:43368874-43368896 AAAGGTTCAACTCTGTTAGTTGG - Intergenic
1053986463 9:43999427-43999449 AAAGGTTCAACTCTGTTAGTTGG - Intergenic
1054039227 9:44911247-44911269 AAAGGTTCAACTCTGTTAGTTGG - Intergenic
1054063534 9:45324539-45324561 AAAGGTTCAACTCTGTTAGTTGG - Intergenic
1054065664 9:45361438-45361460 AAAGGTTCAACTCTGTTAGTTGG - Intergenic
1054067583 9:45394439-45394461 AAAGGTTCAACTCTGTTAGTTGG - Intergenic
1054077598 9:60554881-60554903 AAAGGTTCAACTCTGTTAGTTGG + Intergenic
1054083003 9:60647233-60647255 AAAGGTTCAACTCTGTTAGTTGG + Intergenic
1054084924 9:60680220-60680242 AAAGGTTCAACTCTGTTAGTTGG + Intergenic
1054162644 9:61685822-61685844 AAAGTTTTAACTCTGTGAGTTGG - Intergenic
1054422199 9:64950393-64950415 AAAGGTTCAACTCTGTGAGTTGG - Intergenic
1057610119 9:96535027-96535049 AAAGATATATCTCTGTAAGTAGG - Intronic
1057721317 9:97534396-97534418 AAAGGTCTCACTCTCTAGCTTGG + Intronic
1058863694 9:109142477-109142499 AAGGGTCTCACTCTGTCATCCGG - Intronic
1058907589 9:109494410-109494432 CAAGGTCTCACTCTGTCATCAGG - Intronic
1058969285 9:110065252-110065274 CAAGGTCTCACTCTGTCACCAGG + Intronic
1059105761 9:111510030-111510052 TAAGGTCTCACTCTGTCACCCGG - Intergenic
1203593622 Un_KI270747v1:98102-98124 AAAGGTTCAACTCTGTTAGTTGG - Intergenic
1185734673 X:2487808-2487830 AAAGGTCTCTCTTTTTAAGAAGG + Exonic
1187279407 X:17846448-17846470 ATAGGTCAGACTCTGTAAGCAGG - Intronic
1187609070 X:20920721-20920743 AAAGGACTCAGTATGTATGTGGG - Intergenic
1188062246 X:25616141-25616163 AAAGGTATCATTCTGTAATGAGG - Intergenic
1188817687 X:34735577-34735599 AAAGATCTTACTCTGCACGTAGG - Intergenic
1189200702 X:39193455-39193477 AAAGGACTTACTCTGTCTGTTGG - Intergenic
1189849226 X:45162474-45162496 AAAGGTCTCACTCTGTAAGTGGG - Intronic
1191262744 X:58344778-58344800 AAAGGTTTAACTCTGTGAGATGG - Intergenic
1191269044 X:58438262-58438284 AAAGGTTTAACTCTGTGAGATGG + Intergenic
1191269372 X:58443393-58443415 AAAGGATTAACTCTGTAAGATGG + Intergenic
1192395128 X:70772547-70772569 CAAGGTCTCACTCTGTCACCAGG - Intronic
1193503883 X:82315576-82315598 CAAGGTCTCACTCTGTCACCAGG - Intergenic
1194068471 X:89290616-89290638 AGAGATTTCCCTCTGTAAGTTGG - Intergenic
1195094447 X:101491330-101491352 CAAGGTCTCACGCTGGGAGTTGG - Exonic
1195921587 X:109989168-109989190 CAAGGTCTCACTCTGTGACCTGG - Intergenic
1196163611 X:112513722-112513744 CAAGGTCTCACTCTGTCACCTGG - Intergenic
1197161969 X:123333899-123333921 CCAGGTGTCTCTCTGTAAGTTGG + Intronic
1198077654 X:133210101-133210123 CAAGGTCTCACTCTGTCACCTGG + Intergenic
1199385131 X:147214608-147214630 CAGGGTCTCACTCTGTAACCCGG - Intergenic