ID: 1189849227

View in Genome Browser
Species Human (GRCh38)
Location X:45162475-45162497
Sequence CAAAGGTCTCACTCTGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189849227_1189849232 29 Left 1189849227 X:45162475-45162497 CCACTTACAGAGTGAGACCTTTG 0: 1
1: 0
2: 1
3: 12
4: 218
Right 1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG 0: 1
1: 0
2: 1
3: 9
4: 124
1189849227_1189849228 -8 Left 1189849227 X:45162475-45162497 CCACTTACAGAGTGAGACCTTTG 0: 1
1: 0
2: 1
3: 12
4: 218
Right 1189849228 X:45162490-45162512 GACCTTTGTCTACTTCTGTTTGG 0: 1
1: 0
2: 3
3: 17
4: 160
1189849227_1189849230 2 Left 1189849227 X:45162475-45162497 CCACTTACAGAGTGAGACCTTTG 0: 1
1: 0
2: 1
3: 12
4: 218
Right 1189849230 X:45162500-45162522 TACTTCTGTTTGGCATGTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189849227 Original CRISPR CAAAGGTCTCACTCTGTAAG TGG (reversed) Intronic
906825844 1:48978987-48979009 CAAAGGTCTCCATTTGTAAAGGG - Intronic
908623867 1:66017959-66017981 CCCAGGTGTCAATCTGTAAGTGG - Intronic
913482384 1:119301171-119301193 CAAGGCTGTCCCTCTGTAAGGGG + Intergenic
915801541 1:158798785-158798807 CAAATGTCTTACTCTGATAGTGG + Intergenic
917638728 1:176961567-176961589 CCAAGGTCACCCTCTGTAAATGG + Intronic
918245393 1:182655146-182655168 ACAAGGTCACAGTCTGTAAGTGG + Intronic
918260953 1:182795830-182795852 AAAGGATCTCACTCTGTAACAGG - Intronic
920287473 1:204890939-204890961 CAATGGTCTCACCCTGGTAGTGG + Intronic
924664604 1:246058265-246058287 CAAATGTCCCACTCTGGTAGAGG + Intronic
924864666 1:247965631-247965653 TAATGGTCTTACTCTGTGAGAGG - Exonic
1063445165 10:6108908-6108930 GAAAGGTCTCTCTCTGCAGGAGG - Intronic
1065199880 10:23302321-23302343 TAAAGCTCCCCCTCTGTAAGTGG + Intronic
1066095701 10:32069888-32069910 ACAAGGTCTCACTCTGTTACAGG + Intergenic
1066788500 10:39034422-39034444 GAAAGGTTTAACTCTGTGAGAGG + Intergenic
1066791506 10:39069633-39069655 CAAAGGTTTAACTCTCTGAGAGG - Intergenic
1066791688 10:39072012-39072034 CAAAGGTTTAACTGTGTAAGAGG - Intergenic
1066793125 10:39088259-39088281 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1066794465 10:39103954-39103976 TAAAGGTTTCACTCTGTGAAAGG - Intergenic
1066795726 10:39118400-39118422 CAAAGGCTTAACTCTGTGAGAGG - Intergenic
1066796293 10:39125165-39125187 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1066800021 10:39176512-39176534 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1066805868 10:39252329-39252351 GAAAGGTTTAACTCTGTGAGAGG + Intergenic
1066848504 10:40063167-40063189 CAAAGGTTCAACTCTGTGAGTGG - Intergenic
1066854123 10:40174885-40174907 CAAAGGTTCAACTCTGTGAGTGG - Intergenic
1066861966 10:40330399-40330421 CAAAGGTTCAACTCTGTGAGTGG - Intergenic
1066872104 10:40531839-40531861 CAAAGGTTCAACTCTGTGAGTGG - Intergenic
1066901691 10:41116674-41116696 CAAAGGTTCAACTCTGTGAGTGG - Intergenic
1066921203 10:41499782-41499804 GAAAGGTTAAACTCTGTAAGTGG - Intergenic
1066921324 10:41502157-41502179 GAAAGGTTAAACTCTGTAAGTGG - Intergenic
1066921446 10:41504533-41504555 GAAAGGTTAAACTCTGTAAGTGG - Intergenic
1066921672 10:41508945-41508967 GAAAGGTTAAACTCTGTAAGTGG - Intergenic
1066921793 10:41511319-41511341 GAAAGGTTAAACTCTGTAAGTGG - Intergenic
1066921911 10:41513694-41513716 GAAAGGTTAAACTCTGTAAGTGG - Intergenic
1066922037 10:41516069-41516091 GAAAGGTTAAACTCTGTAAGTGG - Intergenic
1066922158 10:41518444-41518466 GAAAGGTTAAACTCTGTAAGTGG - Intergenic
1066922261 10:41520479-41520501 GAAAGGTTAAACTCTGTAAGTGG - Intergenic
1066922387 10:41522855-41522877 GAAAGGTTAAACTCTGTAAGTGG - Intergenic
1066922613 10:41527266-41527288 GAAAGGTTAAACTCTGTAAGTGG - Intergenic
1066922734 10:41529641-41529663 GAAAGGTTAAACTCTGTAAGTGG - Intergenic
1066922849 10:41532016-41532038 GAAAGGTTAAACTCTGTAAGTGG - Intergenic
1066922974 10:41534391-41534413 GAAAGGTTAAACTCTGTAAGTGG - Intergenic
1066923332 10:41541515-41541537 GAAAGGTTAAACTCTGTAAGTGG - Intergenic
1066923449 10:41543890-41543912 GAAAGGTTAAACTCTGTAAGTGG - Intergenic
1067291441 10:44946333-44946355 CAGAGGTTTCACACTGAAAGGGG - Intergenic
1070522173 10:77263604-77263626 CCAAGGTCTTACTTTGTAAAAGG + Intronic
1072082169 10:92043477-92043499 CAAATGACTCCCTTTGTAAGTGG - Intergenic
1074389135 10:113042307-113042329 CAAAGGTCTCCATCTACAAGAGG - Intronic
1074691683 10:116011405-116011427 AAAAGCTCTCTCTCTGCAAGGGG + Intergenic
1075101607 10:119510144-119510166 CAAGGGGCTCAGGCTGTAAGAGG + Intronic
1080106814 11:28519604-28519626 CAAAGGTCCTACTGTGAAAGGGG + Intergenic
1082093458 11:48108056-48108078 ACAAGGTCTCACTCTGTCACAGG - Intronic
1082145249 11:48658823-48658845 GAAATGTATAACTCTGTAAGAGG - Intergenic
1082149015 11:48708847-48708869 GAAAGGTTTAACTCTGTGAGAGG + Intergenic
1082571498 11:54745787-54745809 GAAAGGTTTAACTCTGTGAGAGG + Intergenic
1082574053 11:54781334-54781356 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1082576069 11:54805115-54805137 GAAAGGTTTAACTCTGTGAGAGG + Intergenic
1082580391 11:54859583-54859605 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1082580519 11:54861632-54861654 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1082590620 11:55004438-55004460 GAAAGGTTTAACTCTGTGAGAGG + Intergenic
1082592856 11:55035350-55035372 CAAAGGTTTAACTCTGTCAGAGG + Intergenic
1085907632 11:80783300-80783322 CAAAGCCATCACTTTGTAAGTGG - Intergenic
1086032650 11:82378822-82378844 CAAAGGTGTGTCTTTGTAAGGGG - Intergenic
1086328062 11:85724920-85724942 CAAAGGCCTCCCTCAGGAAGTGG - Intronic
1086926410 11:92645005-92645027 AAAATGGCTCACTCTGTTAGAGG - Intronic
1090665596 11:128913147-128913169 CAAAGGTCTCTCCAAGTAAGGGG - Intronic
1094158839 12:27368428-27368450 CAAAGATCTCACTGGGTTAGAGG - Intronic
1095075831 12:37923378-37923400 GAAAGGTTTAACTCTGTAAGAGG + Intergenic
1096525071 12:52205523-52205545 CAGAGGTCTCCCTCAGTAAATGG - Intergenic
1097367166 12:58729648-58729670 ACAAGGTCTCACTCTGTTGGAGG - Intronic
1101220327 12:102632334-102632356 CAAAGGTCTCAAAAAGTAAGGGG - Intergenic
1108245756 13:48511791-48511813 CAAAGCTGCCACTCTGCAAGGGG + Exonic
1109501751 13:63246157-63246179 TAAACTTCTGACTCTGTAAGTGG - Intergenic
1110136764 13:72077229-72077251 CAAAGGACTCACTGTGAATGTGG + Intergenic
1110308167 13:74014747-74014769 CCAAGGTCTCCGTCTGTAAAGGG + Intronic
1110387537 13:74931551-74931573 CAATGGTTTCACTCTGGGAGGGG + Intergenic
1114853077 14:26404057-26404079 CAGAGCTCACAGTCTGTAAGTGG + Intergenic
1116326690 14:43539320-43539342 CAAAGCCTTCACTCTGGAAGGGG - Intergenic
1117952990 14:61101163-61101185 AAAAGGTATCACTTTGTCAGAGG - Intergenic
1118943745 14:70362946-70362968 ACAAGGTCTCACTTTGGAAGGGG + Intronic
1119196538 14:72721161-72721183 CAAAGGCATCACTCTCTATGTGG + Intronic
1119947309 14:78708518-78708540 AAAAAGTCTAACACTGTAAGAGG + Intronic
1128033592 15:64503208-64503230 CACAGAGCTCACTCTGTCAGAGG - Intronic
1128728355 15:70004485-70004507 CAAAGGACTCACTGTGTGAAGGG - Intergenic
1134809253 16:17153288-17153310 CCAAGGTCACACACTGTGAGTGG + Intronic
1137045784 16:35659114-35659136 CAAAAGTTTAACTCTGTGAGAGG - Intergenic
1137047465 16:35682381-35682403 CAAAGGTGTAATTCTGTGAGAGG - Intergenic
1137072716 16:35919650-35919672 GAAAGGTTTAACTCTGTGAGAGG + Intergenic
1141477644 16:84284361-84284383 TCAAGGTCTGACTCTCTAAGAGG + Intergenic
1143211949 17:5194897-5194919 ACAAGGTCTCACTCTGTCAGTGG + Intergenic
1145364372 17:22244401-22244423 CAAAGGTATAACGCTTTAAGAGG + Intergenic
1150675494 17:67243655-67243677 CAAATGTATCACTCAGTCAGTGG - Intronic
1152280714 17:79383600-79383622 CCATGCTCTGACTCTGTAAGGGG - Intronic
1155319205 18:24602261-24602283 CAATGGTCTCATTCTTTAAATGG - Intergenic
1158353648 18:56591985-56592007 TAAAGGTCTCAATCCTTAAGTGG - Intergenic
1161037560 19:2093877-2093899 CTTAGTTCTCACTCTGTAATCGG + Intronic
1164334347 19:24296964-24296986 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1164359239 19:27483521-27483543 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1164362270 19:27526958-27526980 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1164378873 19:27714663-27714685 CAAATGTGTAACTTTGTAAGAGG + Intergenic
928846214 2:35676380-35676402 CAAATCTCTCACTCTGGAATTGG + Intergenic
929185111 2:39085927-39085949 CAAAAGTATAACTATGTAAGAGG + Intronic
929298535 2:40274833-40274855 AGAAGGTCTCTCTCTGTAAATGG + Intronic
930849783 2:55947631-55947653 CAAAGTTCTCTGACTGTAAGTGG - Intergenic
934470249 2:94521080-94521102 GAAAGGTTTCACACTGTGAGTGG + Intergenic
934471935 2:94553337-94553359 GAAAGGTTTAACTCTGTGAGTGG + Intergenic
936278183 2:111118152-111118174 CAAAGGTCTCCTGCTGTTAGCGG + Exonic
939402565 2:141713105-141713127 ACAGGGTCTCACTCTGTCAGTGG + Intronic
939412198 2:141842622-141842644 AAAATGTGTCACACTGTAAGTGG + Intronic
940856364 2:158731393-158731415 CAAAGGGCTCTCTCTTGAAGGGG + Intergenic
942559313 2:177203361-177203383 AAACGGTCTCTCTCTGTAAAAGG - Intergenic
949072686 2:242035511-242035533 CAGAGGCCTCACCCTGAAAGTGG + Intergenic
1169869356 20:10234845-10234867 AAAAAGTATCACTCTGAAAGTGG - Intronic
1170169546 20:13395123-13395145 CAATGATCTCTCTCTGGAAGAGG - Intronic
1171739547 20:28863786-28863808 CAAAGGTCCAACTCTGTGTGAGG - Intergenic
1171825987 20:29906536-29906558 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1172233203 20:33351107-33351129 ACAAGGTCTCACTCTGTCACCGG + Intergenic
1172340302 20:34152437-34152459 CAAAAGTCACACTGTGGAAGGGG - Intergenic
1172834908 20:37867031-37867053 CAAGGGTCTTTCTCTGTAAGTGG + Intronic
1173093594 20:40001784-40001806 CAATGGTCTCAGTCTATGAGTGG + Intergenic
1173572270 20:44085146-44085168 GAATGGTCTCACTCTGTTTGCGG + Intergenic
1176759539 21:10766351-10766373 GAAAGGTTTAACTCTGTGAGAGG + Intergenic
1176896889 21:14390248-14390270 CAAATGCCTCATCCTGTAAGAGG + Intergenic
1177854404 21:26384952-26384974 CAAAGGTCTCATTATGTAACTGG - Intergenic
1181595596 22:23912531-23912553 TAAATGTCCCAGTCTGTAAGTGG + Intergenic
1182679061 22:32064173-32064195 CAAAAGTTTCATTCTGCAAGTGG - Intronic
1182786706 22:32913865-32913887 CAAAAGTCTCACTCTTTAACGGG + Intronic
1183383565 22:37502655-37502677 CAAAGGCCACACGCTGTCAGAGG + Exonic
1184398140 22:44257471-44257493 CAGAGGGCTCAATGTGTAAGTGG - Intronic
950904413 3:16524820-16524842 AAGAGGACTCACCCTGTAAGAGG + Intergenic
951902742 3:27673024-27673046 CAATGGTCTCACTCTAAGAGAGG + Intergenic
954084345 3:48232377-48232399 CAGAGTTCTTACTTTGTAAGAGG - Intergenic
954119937 3:48491670-48491692 CAAGGGTCTCACTCTGTCCCAGG + Intronic
958212830 3:90511952-90511974 GAAAGGTTAAACTCTGTAAGCGG + Intergenic
958219488 3:90646466-90646488 CAAAGGTTCAACTCTGTGAGTGG + Intergenic
958408378 3:93779002-93779024 GAAAGGTTTAACTCTGTGAGAGG + Intergenic
958408429 3:93780025-93780047 GAAAGGTTTAACTCTGTGAGAGG + Intergenic
960132937 3:114076691-114076713 CAAAGGTCTCATACTGAAAATGG + Intronic
960296733 3:115953929-115953951 CAAATGTCTCGTTCTGTAAGAGG + Intronic
962915193 3:139894853-139894875 CCAAGGTCACAGTTTGTAAGAGG - Intergenic
967128370 3:186447403-186447425 CAAAGTTCTCATTCTGTCATAGG + Intergenic
967528520 3:190522112-190522134 CCACTGTCTCACTCTGTAATTGG - Intronic
970526361 4:16936508-16936530 CAAAGTTCTCATTTTGTAAATGG + Intergenic
973302086 4:48597450-48597472 CAAATGTATCACTCTGAAGGGGG + Intronic
973756323 4:54077723-54077745 CAAAGATCCCACTCTGCCAGTGG + Intronic
974698463 4:65406115-65406137 CAAAGATCTCCCTCTGGGAGAGG + Intronic
975554978 4:75653522-75653544 CTAAGCTCTCAGTGTGTAAGTGG - Intronic
977148927 4:93483844-93483866 CAAAGGTCTGACTCTGAAGTTGG - Intronic
982870107 4:160568601-160568623 CTATGCTCTCACTCTGTAACTGG - Intergenic
983252746 4:165363237-165363259 CACAGGTTTCCCTCTGAAAGAGG + Intronic
985890384 5:2710743-2710765 AAAAGGTATTGCTCTGTAAGGGG - Intergenic
986321973 5:6638873-6638895 CAATGGTCTCACGTTGTTAGGGG + Intronic
986452122 5:7876685-7876707 CCAAGATCTCAGTCAGTAAGTGG - Intronic
987891634 5:23886438-23886460 CACAGGTTTAACTCTGTGAGAGG - Intergenic
987914044 5:24188601-24188623 AAAAGCTCTCACGCTGAAAGAGG + Intergenic
988667459 5:33345266-33345288 GAAAGGTCTGTCTCTGTGAGAGG - Intergenic
989841432 5:46077187-46077209 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
989853748 5:46251533-46251555 GAAAGGTTTAACTCTGTGAGAGG + Intergenic
989853884 5:46253754-46253776 TAAAGGTTTAACTCTGTGAGAGG + Intergenic
989855373 5:46280492-46280514 GAAAGGTTTAACTCTGTGAGTGG + Intergenic
989855960 5:46291561-46291583 GAAAGGTTTAACTCTGTGAGAGG + Intergenic
989865158 5:46493800-46493822 CAAAGGTCCAAGTCTGTGAGTGG - Intergenic
989866119 5:46510372-46510394 CAAAGGTCCAAGTCTGTGAGTGG - Intergenic
989867317 5:46531088-46531110 CAAAGGTCCAAGTCTGTGAGTGG - Intergenic
989869048 5:46561600-46561622 CAAAGGTCCAAGTCTGTGAGTGG - Intergenic
995046368 5:107653200-107653222 CAAAGGTTTCACTCAGAAATGGG + Intronic
998387396 5:141765595-141765617 CAAAGGTCACACCTTGTTAGTGG + Intergenic
998587634 5:143444052-143444074 CCAAGGTCTTCATCTGTAAGAGG + Intergenic
998666806 5:144306998-144307020 CTAGGGCCTCATTCTGTAAGTGG - Intronic
1000247421 5:159460217-159460239 CAAAGGGCTCTTTCTGTCAGTGG + Intergenic
1003622249 6:7711102-7711124 TAAAGGTCTCCCTCTGTAATAGG + Intergenic
1009063971 6:58433962-58433984 GAAAGGTTTAACTCTGCAAGCGG - Intergenic
1009251856 6:61311595-61311617 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1009252095 6:61315359-61315381 CAAACGTTTAACTCTGTGAGAGG - Intergenic
1012498705 6:99864225-99864247 TCAAGATCTCACTCTGTAACAGG + Intergenic
1014095502 6:117455460-117455482 CAAAGTACTCAATCTGTCAGAGG + Intronic
1015816649 6:137218483-137218505 CTTAGGTCTCAGTCTGGAAGTGG - Intronic
1018212726 6:161497605-161497627 CAAAGTATTCAGTCTGTAAGTGG - Intronic
1018399254 6:163405766-163405788 CACAAGTCTCAGACTGTAAGTGG - Intergenic
1025349553 7:58638574-58638596 GAAAGGTCAAACTCTGTGAGTGG - Intergenic
1025434822 7:60151464-60151486 GAAAGGTCAAACTCTGTGAGTGG - Intergenic
1025520178 7:61718597-61718619 CAAAGGTTCAACTCTGTGAGAGG + Intergenic
1025521792 7:61742793-61742815 CAAAGGTTCAACTCTGTGAGAGG + Intergenic
1025526554 7:61820226-61820248 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1025544500 7:62147252-62147274 CAAAGGTTCAACTCTGTGAGAGG + Intergenic
1025549929 7:62232782-62232804 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1025579478 7:62693744-62693766 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1025583296 7:62747544-62747566 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1025588126 7:62819134-62819156 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1025592729 7:62883135-62883157 CAAAGGTTTAACTCTGTGAGAGG - Intergenic
1025596040 7:62927257-62927279 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1025599508 7:62977634-62977656 GAAAGGTTTCACTGTGTGAGAGG - Intergenic
1027890592 7:83968326-83968348 CAAAGGTCTCACTCAGCATAGGG - Intronic
1029235647 7:99115551-99115573 ACAGGGTCTCACTCTGTCAGTGG - Intronic
1029320044 7:99750779-99750801 CAAATGTGTCACTCTGTGTGTGG - Intergenic
1031869044 7:127072443-127072465 CCAAGGTCTCACTGTGTTTGTGG + Intronic
1034315869 7:150132638-150132660 CAAAGCTCACACACTGTCAGTGG + Intergenic
1034791022 7:153968163-153968185 CAAAGCTCACACACTGTCAGTGG - Intronic
1035950834 8:4018808-4018830 CCAAGGTCCCACGCTGTATGTGG - Intronic
1040113645 8:43589163-43589185 AAAAGGTTTAACTCTGTGAGAGG - Intergenic
1040114420 8:43599359-43599381 AAAAGGTTTGACTCTGTGAGAGG - Intergenic
1040117015 8:43633681-43633703 GAAAGGTTTAACTCTGTGAGAGG - Intergenic
1040125030 8:43727450-43727472 CAAAGGTTTAACACTGTGAGAGG - Intergenic
1040132248 8:43810843-43810865 TAAAGGTTTAACTCTGTGAGAGG - Intergenic
1040152570 8:44142376-44142398 CAAAGGTTCAACTCTGTTAGTGG - Intergenic
1040209392 8:44983964-44983986 CAAAGGTTCAACTCTGTAAGTGG - Intergenic
1040251410 8:45603930-45603952 GAAAGGTCCAACTCTGTTAGTGG - Intergenic
1040271060 8:45944001-45944023 GAAAGGTCCAACTCTGTTAGTGG - Intergenic
1040282894 8:46075540-46075562 GAAAGGTTTAACTCTGTTAGCGG - Intergenic
1040898709 8:52394612-52394634 CAAAGCTCTCTCTCTTTAAATGG + Intronic
1043266099 8:78269195-78269217 CAAAGGTCACCCCATGTAAGTGG + Intergenic
1044406596 8:91833882-91833904 CAAAGTGCTCTCGCTGTAAGTGG - Intergenic
1045139211 8:99261077-99261099 CAAATGTATCACTCTGATAGGGG - Intronic
1045866672 8:106874126-106874148 CAATGTTCTCACTCTGTTGGCGG + Intergenic
1047245081 8:123135381-123135403 AAAAGGTCTGACTTTTTAAGTGG - Intronic
1048414996 8:134217835-134217857 CAAAGCTGTCAGTCTGTCAGGGG - Intergenic
1048868186 8:138776212-138776234 CTCACGTCTCACTCTGGAAGTGG - Intronic
1050312143 9:4364134-4364156 CAAGGGTCTCATTCTAAAAGTGG + Intergenic
1053938415 9:43196963-43196985 GAAAGGTTTAACTCTGTGAGTGG - Intergenic
1059366374 9:113789595-113789617 CTAAGCACTCACTCTGTATGAGG + Intergenic
1059884457 9:118729948-118729970 CAATGGTCTTAGTCTGTAAAAGG + Intergenic
1203356162 Un_KI270442v1:148222-148244 GAAAGGTTTAACTCTGTGAGAGG + Intergenic
1203397605 Un_KI270519v1:40474-40496 GAAAGGTTTAACTCTGTGAGAGG + Intergenic
1203416480 Un_KI270591v1:3638-3660 GAAAGGTTTCACTCAGTGAGAGG + Intergenic
1189849227 X:45162475-45162497 CAAAGGTCTCACTCTGTAAGTGG - Intronic
1189943943 X:46157730-46157752 CTAATGTCTCCCTCTGTAAATGG + Intergenic
1190797047 X:53755709-53755731 CAGAGGTTCCACTCTGGAAGAGG - Intergenic
1191260558 X:58315080-58315102 GAAAGGTTTCACCCTGTGAGAGG - Intergenic
1191265141 X:58381374-58381396 GAAAGGTTTAACTCTGTGAGAGG + Intergenic
1191583866 X:62797295-62797317 CAAAGGTTTAACACTGTAAGAGG + Intergenic
1191583938 X:62798604-62798626 CAAAGGTTTCACACTGTAAGAGG + Intergenic
1191584050 X:62800329-62800351 CAAAAGTTTAACTCTGTCAGAGG + Intergenic
1199080655 X:143573030-143573052 CTAAGGCCTCAATTTGTAAGAGG + Intergenic