ID: 1189849232

View in Genome Browser
Species Human (GRCh38)
Location X:45162527-45162549
Sequence GTGCAAACCCACAATTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189849229_1189849232 12 Left 1189849229 X:45162492-45162514 CCTTTGTCTACTTCTGTTTGGCA 0: 1
1: 0
2: 4
3: 13
4: 251
Right 1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG 0: 1
1: 0
2: 1
3: 9
4: 124
1189849227_1189849232 29 Left 1189849227 X:45162475-45162497 CCACTTACAGAGTGAGACCTTTG 0: 1
1: 0
2: 1
3: 12
4: 218
Right 1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG 0: 1
1: 0
2: 1
3: 9
4: 124
1189849226_1189849232 30 Left 1189849226 X:45162474-45162496 CCCACTTACAGAGTGAGACCTTT 0: 1
1: 0
2: 1
3: 17
4: 373
Right 1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG 0: 1
1: 0
2: 1
3: 9
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189849232 Original CRISPR GTGCAAACCCACAATTATAT TGG Intronic
900758339 1:4453483-4453505 GTGCAAAGTCACAATCAGATAGG + Intergenic
911285543 1:95987739-95987761 GTCCAAACACAGAAATATATTGG + Intergenic
911708844 1:101045424-101045446 TTGCAAAACCTAAATTATATTGG + Intergenic
913120796 1:115738832-115738854 GTGCAAAGCCTCAATTAGACAGG - Intronic
915056978 1:153142098-153142120 GGTCAAACCCAGGATTATATAGG - Intergenic
916714459 1:167437747-167437769 GTACAAAGCCTCAATTAGATAGG + Intronic
918877515 1:190067912-190067934 GGCCAAACCCACAATCACATGGG + Intergenic
919681351 1:200437931-200437953 GAGAAAACCCACAATTAGTTTGG - Intergenic
1065986330 10:30956513-30956535 GTGCAAACCTACAGTCACATAGG - Intronic
1066692371 10:38043006-38043028 GTTCAAATCCACAATTATTGTGG - Intronic
1068640993 10:59407671-59407693 GTGCAAAGTTACAGTTATATAGG - Intergenic
1074010884 10:109478280-109478302 TTGCAAACACAAAATTATACAGG - Intergenic
1076713163 10:132350219-132350241 CTGAAATCCCAAAATTATATTGG + Intronic
1077548810 11:3190181-3190203 GTGCAAAGACACAAATAAATAGG + Intergenic
1079839524 11:25378851-25378873 GTTCAAAGCCACAGTTAAATAGG - Intergenic
1080857529 11:36125145-36125167 GTGCAGACCCACAATCATAAAGG - Intronic
1087542791 11:99542496-99542518 GGCAAAACCCACAATTATTTTGG - Intronic
1093189235 12:16056124-16056146 GTGCAAATACACAATTCGATAGG + Intergenic
1093943927 12:25085918-25085940 ATGCAAACCCACAAATACAGAGG + Intronic
1094112353 12:26875064-26875086 ATGCAAACTCAAAATTATTTTGG + Intergenic
1095324848 12:40877052-40877074 GTTCATACTCACAATTATTTTGG - Intronic
1097419131 12:59352245-59352267 ATGCAAACCCACACTCATACTGG + Intergenic
1097976059 12:65687680-65687702 GTACAAAGCTACAATTAAATAGG + Intergenic
1098391650 12:69975961-69975983 GTGCAAACACACACACATATTGG + Intergenic
1099179531 12:79461178-79461200 GTGTAAACCCACTATGATAATGG - Intergenic
1104275279 12:127321250-127321272 GTGCTAATTCACAATTATCTGGG - Intergenic
1104561557 12:129850049-129850071 TTTCAAATCCACAAATATATGGG - Intronic
1109084778 13:57955965-57955987 GTGCAAAGCCCCAATTAGACAGG - Intergenic
1110025540 13:70534017-70534039 GTGTAAACTCACTAATATATGGG - Intergenic
1111223974 13:85245102-85245124 GTCCAAACCCACAATTTGGTGGG - Intergenic
1111810114 13:93089077-93089099 GTGTACACCCACTACTATATTGG - Intergenic
1111811143 13:93095910-93095932 GTGTATACCCACTATTATATTGG - Intergenic
1112643700 13:101306021-101306043 GTGAAGAGCCACAATTATAGAGG + Intronic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1112769966 13:102784114-102784136 CTGAATACCCACAATAATATGGG + Intergenic
1115221178 14:31060241-31060263 ATGCAAAACCCCAGTTATATGGG + Intronic
1115699718 14:35939956-35939978 GAGCAAATCCAGAATCATATTGG + Intergenic
1116838780 14:49797908-49797930 GTGAAAACCCACAAAGACATGGG - Intronic
1128507141 15:68281416-68281438 CAGCAAACCCATAATTACATGGG - Intronic
1133472705 16:6091156-6091178 GTGCAAACCTACAGTTAGATAGG - Intronic
1133550582 16:6850844-6850866 GTGCAATTGCTCAATTATATGGG - Intronic
1134508788 16:14829495-14829517 GTGTAAACCCACTGTGATATTGG - Intronic
1134696496 16:16228392-16228414 GTGTAAACCCACCGTGATATTGG - Intergenic
1134975334 16:18566305-18566327 GTGTAAACCCACTGTGATATTGG + Intergenic
1148190880 17:45677897-45677919 GTGCAAACCCAGAATAAGCTGGG - Intergenic
1148449151 17:47763314-47763336 AGACAAATCCACAATTATATTGG - Intergenic
1149812079 17:59685483-59685505 TTGCAAAACCAGATTTATATTGG + Intronic
1153558111 18:6339036-6339058 GAACAAACCCACAAATATATTGG + Intronic
1156771348 18:40730506-40730528 GTGGAAAACCACACTTTTATTGG - Intergenic
1158775665 18:60575527-60575549 GTTCAAACACACAATTACAGTGG + Intergenic
1159235603 18:65669037-65669059 GTACAAAGCCACAATTATGCAGG - Intergenic
1163967306 19:20758785-20758807 CTACAAACCCCCAAATATATTGG + Intronic
1164235663 19:23331095-23331117 GTGCAAATACACAAATATTTAGG - Intronic
1165933845 19:39377320-39377342 CTGCAAGCCCACAAACATATAGG - Intronic
927447969 2:23182274-23182296 AGACAAATCCACAATTATATTGG + Intergenic
927584605 2:24290197-24290219 CTGCAAACCCTCATCTATATTGG + Intronic
930609791 2:53528981-53529003 GTGCAGACCCAAAATTCTAGGGG + Intergenic
934590431 2:95544885-95544907 GTGTACACCCACTATGATATTGG + Intergenic
936936826 2:117846954-117846976 TTGCAAAACCACAATTAATTTGG + Intergenic
940714858 2:157209889-157209911 GTACAAATCCACAATTATAGTGG - Intergenic
940930007 2:159416898-159416920 GTTCTCACCCACAATTATTTTGG - Intronic
942516527 2:176759366-176759388 GTACAAAATCACAATTATACAGG - Intergenic
1172534477 20:35662371-35662393 GTGCAAACCAAAAGGTATATGGG + Intronic
1172826354 20:37790385-37790407 GTGCAAAAGCAAAATTATAATGG + Intronic
1173399895 20:42715926-42715948 GTGCAAATCCAGAGATATATGGG + Intronic
1174971347 20:55279339-55279361 GTACAGACTCATAATTATATTGG - Intergenic
1181028013 22:20136814-20136836 GTGCACACACACAAATATACAGG - Intronic
1183639226 22:39083170-39083192 TTACAAAACCACAATTATAAAGG - Intronic
949637784 3:6002915-6002937 GAGAAAACCCACAATTCAATAGG + Intergenic
949707645 3:6837389-6837411 CTGCAAACCCAAAAATATGTTGG - Intronic
950554189 3:13685385-13685407 GTGGAAACCCAAATTTGTATGGG - Intergenic
951035614 3:17928702-17928724 GTGGAAACCCAGATTTATAAGGG - Intronic
951363859 3:21756660-21756682 GAGCAAAAGCACAAGTATATGGG + Intronic
951770741 3:26254505-26254527 GTACAAACTCACAGTTATGTAGG - Intergenic
953636098 3:44666385-44666407 GTGCACACGCACACGTATATGGG - Intergenic
955563701 3:60221935-60221957 GTGCATACCCACATTTATATAGG - Intronic
957436136 3:80178666-80178688 GTGTAAAAGTACAATTATATTGG - Intergenic
958537653 3:95425067-95425089 CTGCAAAGCCACAGGTATATGGG - Intergenic
964513949 3:157485990-157486012 TGGCAAACCCAAAATTATAATGG + Intronic
966661751 3:182422179-182422201 GTGAAAAAGCACAATGATATAGG - Intergenic
967236887 3:187393683-187393705 GAGCAACACCACAATTAGATGGG - Intergenic
967760437 3:193218270-193218292 GTGCAAAGTCATAGTTATATTGG + Intergenic
968469161 4:770375-770397 TTGCAAACCCTCATTTAAATTGG + Exonic
970926872 4:21462202-21462224 GTGAAAACACACAAATACATGGG - Intronic
973134780 4:46693474-46693496 ATGCACACACACAATTATAAAGG + Intergenic
977071425 4:92393163-92393185 GTGAGAACTCACTATTATATAGG + Intronic
978524177 4:109647842-109647864 GTGCGGACACACAATTATGTGGG - Intronic
980613745 4:135192420-135192442 GAGCACACCCACAGTTATACAGG + Intergenic
981032299 4:140137374-140137396 GTTAAAACCCACAACCATATGGG - Intronic
981710279 4:147702038-147702060 GTACAAAGCTACAATTAGATTGG + Intergenic
984448495 4:179868666-179868688 GTGCAAATATACAATTTTATAGG - Intergenic
985860136 5:2464358-2464380 GTGCAAACCCACATGTTCATTGG + Intergenic
987273092 5:16333293-16333315 GTGAAAACCCACAAATATAGAGG + Intergenic
988219227 5:28319844-28319866 ATGCTAACCTACAATTATATAGG + Intergenic
994508986 5:100679401-100679423 GTGCAAAGTTACAATTAGATAGG - Intergenic
995433734 5:112111940-112111962 GTACTAACCCACAATTGTCTTGG + Intergenic
996313805 5:122138337-122138359 ATGCAAACCCACAATAAGAGGGG + Intronic
997447728 5:133953651-133953673 GTGCACATCCACAATTCTACGGG - Intergenic
998840776 5:146251264-146251286 GTGCAAACCTGAAATTATGTGGG + Intronic
998936309 5:147234101-147234123 GTGTACACCCACTACTATATTGG - Intergenic
1004628799 6:17401692-17401714 ATGCAGATCCACAATTATTTAGG + Intronic
1005286180 6:24329476-24329498 CTGCAATCCCAAAATTATAATGG + Intronic
1005581924 6:27243353-27243375 AAGCAAACCCACAATTTTTTGGG + Intergenic
1008311804 6:49985381-49985403 GTGAAAAAACACAATTTTATTGG + Intergenic
1009367598 6:62867921-62867943 GTGTAAACCCCCTATGATATTGG + Intergenic
1011273834 6:85607999-85608021 GCTAAAACCCACAAATATATTGG + Intronic
1012645696 6:101677869-101677891 GTGAAAATCAACATTTATATTGG - Intronic
1012688962 6:102290397-102290419 GTACAAAGCTACAATTAGATAGG - Intergenic
1021442754 7:20697193-20697215 TGGCTAACCCACATTTATATTGG - Intronic
1024532257 7:50403126-50403148 GTGCAAAGAGACATTTATATTGG - Intronic
1024553727 7:50584974-50584996 GTGCAAACCCACAGATCTCTGGG - Intergenic
1025148844 7:56529321-56529343 GTGAAAACCCTCAATAAAATAGG + Intergenic
1029788386 7:102816584-102816606 GTGCAAACACACAGCTACATAGG - Intronic
1033789937 7:144779331-144779353 ATACACACACACAATTATATAGG - Intronic
1037169020 8:15867589-15867611 GTGCGAAGTCACAATTATAAAGG + Intergenic
1037650315 8:20831513-20831535 GTGCAAACCCATAATAATCATGG - Intergenic
1039244677 8:35595842-35595864 GTGCAAACACAGAAGTAGATGGG - Intronic
1039655656 8:39402552-39402574 TTGTAAACCCACATTTATATAGG - Intergenic
1040002204 8:42587032-42587054 CTGCAAACCCAAAGTTATCTAGG + Intergenic
1045292058 8:100842184-100842206 GACAAAACCCACAATTATTTTGG + Intergenic
1045816598 8:106283824-106283846 GTGAAACCTCACAATTATTTAGG + Intronic
1048694292 8:137007449-137007471 ATTCAAACCCTCAATTTTATTGG + Intergenic
1050902682 9:10966434-10966456 GTGCACACCCCCTATGATATTGG - Intergenic
1052797319 9:32935034-32935056 TTGCAAATAAACAATTATATTGG + Intergenic
1055398603 9:75899491-75899513 GTACAAACTCACAGTTATGTAGG - Intronic
1056686868 9:88773613-88773635 CTGAAAAACCACAATTAAATAGG - Intergenic
1186354860 X:8780433-8780455 GAACAAATCCACCATTATATTGG + Intergenic
1186549985 X:10493531-10493553 GTGCAAAACCTCAATTAGAGAGG + Intronic
1188121468 X:26313809-26313831 GTACAAAGCTACAATTAAATAGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1189876596 X:45442561-45442583 GTACAAAGCTACAATTATATAGG - Intergenic
1191161452 X:57333957-57333979 GAGCAAAGACAGAATTATATTGG + Intronic
1193847049 X:86485412-86485434 GTACAAACCTACAGTTAGATAGG + Intronic
1195501559 X:105606936-105606958 ATACAAACCTACAACTATATAGG + Intronic
1199466976 X:148149112-148149134 GTGCAAAGCCACAATAATTAAGG + Intergenic