ID: 1189851353

View in Genome Browser
Species Human (GRCh38)
Location X:45179173-45179195
Sequence CTTTGTTGGGGGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 632
Summary {0: 1, 1: 0, 2: 8, 3: 67, 4: 556}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189851353_1189851361 25 Left 1189851353 X:45179173-45179195 CCAGCCTCCTTCCCCCAACAAAG 0: 1
1: 0
2: 8
3: 67
4: 556
Right 1189851361 X:45179221-45179243 GTCTTGAGATTGCAAAATCCAGG 0: 1
1: 0
2: 1
3: 14
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189851353 Original CRISPR CTTTGTTGGGGGAAGGAGGC TGG (reversed) Intronic
900303207 1:1988308-1988330 CTTTTCTGTGGGAAGGGGGCTGG + Intronic
900706343 1:4082502-4082524 CTTTACTGGGGGAGGGAGGCTGG + Intergenic
901078753 1:6571819-6571841 CTTTTTTGGGGGGAGGATGGAGG - Intronic
901253106 1:7796667-7796689 CTTTGGAGGGGGAAGAAGGGAGG + Intronic
901634398 1:10663857-10663879 CTCCTCTGGGGGAAGGAGGCAGG + Intronic
901637157 1:10675793-10675815 CTTTGTTGGGGGTGGGGGGGGGG - Intronic
901776941 1:11566595-11566617 CTGTGCTGGCGGAGGGAGGCTGG - Intergenic
902822217 1:18950339-18950361 CTTTGCCAGGGGAAGGGGGCTGG + Intronic
903006477 1:20302238-20302260 CTTTGGTGGGGGCAGGGGGTTGG - Intronic
903143769 1:21356499-21356521 CTCTGTTGGGGGAAAGAGCTTGG - Intergenic
903228651 1:21908487-21908509 CTTTGCTGGGTGGAGCAGGCTGG - Intronic
903460968 1:23520882-23520904 CTTGGTTGGGGGAAGGTGTCAGG - Intronic
903601546 1:24545591-24545613 CTCCTTTGGGGGAAGGAGCCTGG - Intergenic
903815795 1:26063515-26063537 CTTTATCAGGGGATGGAGGCAGG - Intronic
903891329 1:26572318-26572340 CTTATTTGGAGGAGGGAGGCAGG + Intronic
904492433 1:30869373-30869395 CTTTGATGGGGGAAGATGGCTGG + Intergenic
904821732 1:33249552-33249574 CTTTCTTGGGGGAGTGGGGCAGG - Intergenic
905381421 1:37564233-37564255 CTTTGTTGGGGGGTGGGGGTGGG - Intronic
906527136 1:46500545-46500567 CTTTTTTGGGGGAGGGGGGTAGG - Intergenic
906760627 1:48373867-48373889 CTATGTTGTGGGAAGGACCCAGG - Intronic
906813741 1:48855510-48855532 GTTTTTTGGGGGATGGAGGTGGG + Intronic
907409514 1:54274533-54274555 ATAGGTTGGGGGCAGGAGGCAGG - Intronic
908116021 1:60941040-60941062 TTTTGTTGGGGGTAGGAAGATGG + Intronic
908179854 1:61592978-61593000 CTTTTTTGGGGGAATGGGGACGG - Intergenic
909158020 1:72105455-72105477 CTTTGGTGGGGGGCCGAGGCAGG + Intronic
910591156 1:88929110-88929132 CTTTGGTAGGGAAAGGAGGCGGG - Intergenic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
912337672 1:108877349-108877371 CTTTGTTTTGGGCAGGAGGCGGG + Intronic
912568365 1:110605156-110605178 CTGCATTGGGGGAAGGTGGCTGG + Intronic
912663872 1:111561501-111561523 ATGTATTGGGGGAAGGAGGGAGG + Intronic
912672589 1:111644774-111644796 CTTTTTTTGGGGAAGGGGGAGGG + Intronic
912778812 1:112524990-112525012 GGTGGTTGGGGGAAGGATGCAGG + Exonic
913451755 1:118997554-118997576 CTTTGCTGGGGGCAGGTGGGAGG - Intergenic
914234814 1:145799596-145799618 TTTTGTTGGGGGGAGGGGGTGGG + Intronic
914767028 1:150647380-150647402 CTTAGTTGGGAGACTGAGGCAGG + Exonic
914847730 1:151292193-151292215 CTGGGTTTGGGGAAGGAGTCAGG + Exonic
915014875 1:152723735-152723757 CTCTGTTGGGGGGAGGGGGAGGG + Intergenic
915446743 1:155978477-155978499 TATTGTTGGGGGAAGGCGGGGGG + Exonic
915964833 1:160297502-160297524 GGTTCTTGGGGGAAGGAGGAAGG - Intronic
916122298 1:161539300-161539322 CGTGGGTGGGGGAAGGAGGGAGG + Intergenic
916894834 1:169151533-169151555 CTTGGTTGAGGGCAGGAGGCTGG + Intronic
917106209 1:171494774-171494796 CTTTCTTGAGGGAGGGGGGCAGG - Intronic
917743262 1:177982434-177982456 CTCTCTTGGGGAAGGGAGGCAGG + Intronic
917832318 1:178905209-178905231 CTTTGATATGGGAAGGAGGCTGG - Intronic
918336537 1:183520599-183520621 CTCTGTTGGGGGGAGGGGGAAGG + Intronic
918427917 1:184429005-184429027 CTGGGTTGGGGGATGGAGCCAGG - Intronic
918613010 1:186513367-186513389 ATTTGTTGTGAGATGGAGGCTGG + Intergenic
919050747 1:192508425-192508447 CTTTTTTGGGAGACCGAGGCGGG + Intergenic
919856264 1:201708406-201708428 GTTTGAGGGGGGAAGGGGGCAGG - Intronic
920453333 1:206077526-206077548 CTTTGGGAGGGGAAGGAGGGAGG + Intronic
920762629 1:208800188-208800210 GTTTGCAGGGGGAAGGAGCCTGG + Intergenic
922032868 1:221820760-221820782 GTTAGTTGGGGGAGGGAGGAAGG - Intergenic
922456367 1:225776913-225776935 CTTTGATGGGGTGAGGAGGAGGG - Intergenic
922558116 1:226548635-226548657 TTTGGTTGGGGGGAGGGGGCGGG + Intergenic
922613126 1:226944456-226944478 TCTTGTTGCGGGAAGGAGGAGGG + Intronic
923136666 1:231125868-231125890 CTTTGGTGGGGAAGGGAGGTGGG + Intergenic
923202262 1:231724168-231724190 CTCTGTGTGGGGAAGGGGGCAGG + Intronic
923794181 1:237137223-237137245 CTTTGCTGGTGGAAGGAGCCTGG + Intronic
923818080 1:237402911-237402933 TTTTTTGGGGGGAAGGAGGGTGG - Intronic
924237598 1:242012209-242012231 ATGTGTTGGGTGAAGGAGTCTGG + Intergenic
924633401 1:245763210-245763232 CATTATTGAGGGAAGGAGGAGGG - Intronic
924726416 1:246675758-246675780 CTTTTTTGGGGGCTGGAGGGTGG + Intergenic
1062954959 10:1534020-1534042 CTTTGATGGGGGAGGGAGGGAGG + Intronic
1063519077 10:6724589-6724611 CTCTGCTGGGGTTAGGAGGCAGG + Intergenic
1064000831 10:11662607-11662629 GTGTGTTGGGGGCAGGAGGGAGG - Intergenic
1064826091 10:19402807-19402829 GTTTGGTGGGGGAAGGATGGAGG - Intronic
1064964593 10:21002141-21002163 CCTTGATGTGGGAAGGAGGGAGG + Intronic
1065420772 10:25541711-25541733 CTTTGTTTGAAGTAGGAGGCTGG - Intronic
1066207484 10:33203984-33204006 CTTTGTTGGGAGGCCGAGGCGGG - Intronic
1067534627 10:47099864-47099886 CTGTGCTGGGGCAAGGATGCTGG - Intergenic
1067726081 10:48772144-48772166 ATTTGTTGAGGGAAGGACTCGGG + Intronic
1067726329 10:48773990-48774012 CTCTGTGGGGGGAAGGTGGCTGG - Intronic
1067804476 10:49383419-49383441 CTTTGCTGGGGGCAGGAGGTAGG + Intronic
1068528336 10:58156614-58156636 CTGTTTTGGGGGTAGGAGGCTGG + Intergenic
1068619471 10:59164325-59164347 CCTTGTGGGTGGATGGAGGCAGG - Intergenic
1068734146 10:60392935-60392957 CTTTTTTGGGGGAGGGAGTGGGG - Intronic
1069438334 10:68406684-68406706 CCTTGCTGGGGGGAGGGGGCAGG - Intronic
1069731997 10:70622973-70622995 ATTTTTGGGTGGAAGGAGGCAGG + Intergenic
1070276584 10:75013060-75013082 ATGTCTTTGGGGAAGGAGGCTGG - Intronic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1070646398 10:78205048-78205070 CTTTCCTAGGGGAAGGAGGAAGG - Intergenic
1070727965 10:78804914-78804936 CTATGCTGGTGGTAGGAGGCTGG - Intergenic
1072275726 10:93820857-93820879 CCTTGTTGGGGCCAGGGGGCGGG - Intergenic
1072405986 10:95153367-95153389 GTGGGTTGGGGGAAGGAGGGAGG + Intergenic
1072695546 10:97600351-97600373 CCTTGTTGGCTGAAGGAGGATGG + Intronic
1072778648 10:98227339-98227361 TTTTATTGGGAGAAGGAGGAAGG - Intronic
1074404471 10:113169190-113169212 CTTTGTTGGGGGAATTGGTCCGG + Intergenic
1074780795 10:116800512-116800534 CTTTGTGGGGAGAGGGAGCCAGG + Intergenic
1074786792 10:116849051-116849073 CTCTGTTGGGGGAGGGATGTAGG - Intergenic
1074937906 10:118204362-118204384 GTTGGTTGGGGGCAGCAGGCTGG - Intergenic
1075449136 10:122536069-122536091 GCGTATTGGGGGAAGGAGGCTGG + Intergenic
1075676555 10:124299948-124299970 CTTGGTGGGTGGCAGGAGGCTGG - Intergenic
1077484283 11:2831757-2831779 CTCTGGTGGGGGAGGGAGGAGGG - Intronic
1078448637 11:11424111-11424133 CTTTGTTGGGGGCAGCAGGCAGG - Intronic
1078536118 11:12175850-12175872 CTATGTAGCTGGAAGGAGGCAGG + Intronic
1078579392 11:12526854-12526876 TCTTGTTGGGGGAGGGAGGAAGG + Intronic
1078640681 11:13092925-13092947 CTTTGTGGGGGCAAGGCGGGCGG - Intergenic
1078901094 11:15643630-15643652 ATATGTTGGGGGCAGGGGGCAGG - Intergenic
1079104554 11:17561849-17561871 CTCTCTTGGGGGCAGTAGGCAGG - Intronic
1079296300 11:19237797-19237819 ATTTGTTGGGGGGAGGGGGGAGG - Intronic
1080216389 11:29846378-29846400 CTTTTTTGGGGGGAGGGGACGGG - Intergenic
1080276834 11:30512512-30512534 TGTTGTGGGGGGAAGGAGGGAGG + Intronic
1080504819 11:32902133-32902155 CATTCTTGGGTGAAGGAGTCGGG + Intronic
1080906488 11:36550945-36550967 CTTGGTTCAGTGAAGGAGGCAGG + Intronic
1081781386 11:45715524-45715546 GTTTGCTGGGGGAAGGTGGGAGG - Intergenic
1081985105 11:47296090-47296112 CTTTAATGGGGGAGGGAAGCAGG + Intronic
1082785262 11:57313184-57313206 CAGTGATGGGGGAGGGAGGCGGG + Exonic
1082798252 11:57394378-57394400 CATTTCTTGGGGAAGGAGGCAGG - Intronic
1083041253 11:59689399-59689421 TTTTGTTGGGGGACGAAGTCTGG + Intergenic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1083244524 11:61416171-61416193 TTTGGTGGGGGGAAGAAGGCTGG + Exonic
1083338960 11:61946252-61946274 CTTGGCTGGGGGCAGTAGGCAGG - Intergenic
1083730355 11:64649348-64649370 AGTTGTTGGGGGAAGGGAGCTGG - Intronic
1083818158 11:65149446-65149468 ATTTGGTGGGGTTAGGAGGCAGG - Intergenic
1083909029 11:65694666-65694688 CTTTTTTGGGAGACTGAGGCAGG + Intergenic
1083919669 11:65775538-65775560 CTTTGTGGGTGTCAGGAGGCAGG + Intergenic
1084061348 11:66677563-66677585 CTTTGTTGGGGCGAAGAAGCTGG - Exonic
1084150865 11:67287340-67287362 CATTGGTGTGGGAAGGAGGGAGG + Intergenic
1084615266 11:70231615-70231637 CTGTGAGGGGGTAAGGAGGCAGG + Intergenic
1086599498 11:88615477-88615499 CTCTGGTGGAGGAAGAAGGCTGG - Intronic
1086989809 11:93290481-93290503 CTTTCTTGTGGGAAGGAGTTGGG + Intergenic
1087433060 11:98078107-98078129 CATTGTTTGGGGATGGAGGGCGG - Intergenic
1088326409 11:108605561-108605583 CTTTGCTGGGCGTAGGAGGGGGG - Intergenic
1088823536 11:113475477-113475499 CTTTGGTGGGGGGCGGGGGCGGG - Intronic
1088908199 11:114170560-114170582 CTGGTTTGGGGGAAGGAGGAGGG - Intronic
1088971765 11:114780285-114780307 CTGTCTTGGGCCAAGGAGGCAGG + Intergenic
1089294941 11:117461744-117461766 GATTGTTGGGGCAGGGAGGCTGG + Intronic
1090694866 11:129229825-129229847 TTTTTTTGGGGGTGGGAGGCAGG + Intronic
1090940799 11:131386519-131386541 CTGTGGTGTAGGAAGGAGGCAGG + Intronic
1093437306 12:19150317-19150339 CTGTTTTGGGGGATGGAGGAAGG + Intronic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094472579 12:30817280-30817302 GTTTGTAGGGGGGAGGAGCCTGG + Intergenic
1094741206 12:33291135-33291157 TTTTGTTGGGGGAAGAAGGCAGG + Intergenic
1095409741 12:41908834-41908856 ACTTATTGGGGGAAGGAGGGGGG - Intergenic
1096399033 12:51289998-51290020 CTTTAGTGGGGGCAGGAGGGTGG - Intronic
1096781737 12:53995833-53995855 CTTGGGTGGGGGCAGGACGCGGG + Intronic
1096876485 12:54633934-54633956 GTTGGTTGGGGGAAGGGGCCAGG + Intronic
1097013714 12:55970834-55970856 CATGGTTGGGGGAAGGAAGGAGG + Intronic
1097188992 12:57210581-57210603 CTGGGTTGTGGAAAGGAGGCTGG - Intronic
1097371387 12:58785661-58785683 CCTTATTGGGGAAAGGAGGAAGG + Intronic
1098203973 12:68086384-68086406 CTCTCCTGGGAGAAGGAGGCAGG + Intergenic
1098562823 12:71896186-71896208 TTTTGGTGGGGGAAGTAGGGAGG + Intronic
1098853117 12:75621291-75621313 CTTTGTGTAGGGTAGGAGGCAGG - Intergenic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1099935433 12:89119356-89119378 GTTTGTTGGGGGACGGGGGAAGG - Intergenic
1100188879 12:92168787-92168809 CTTTTCTGGGTGGAGGAGGCTGG - Intergenic
1100297908 12:93279849-93279871 CTTTGTTGGGGGATGGAACATGG - Intergenic
1101427683 12:104601126-104601148 ATTTGTTGGAGGGAGGAGGAAGG - Intronic
1102214405 12:111150298-111150320 CTTTTTTGGGGGGAGGAGGAAGG - Intronic
1102222295 12:111202674-111202696 CATTGGAGGGGGCAGGAGGCGGG + Intronic
1103317297 12:120066454-120066476 CTGGGTTGGGGGAAAGAGGCAGG + Intronic
1103413720 12:120730458-120730480 CTGTGTAGGGAGGAGGAGGCTGG + Intronic
1103493714 12:121344470-121344492 CTTGGTTGGGAGGTGGAGGCAGG + Intronic
1103613460 12:122137890-122137912 CTGTGCTGTGGGGAGGAGGCAGG + Intronic
1103983344 12:124750922-124750944 CTTTCTGGGGTGAAGGGGGCGGG + Intergenic
1104023296 12:125008249-125008271 CTTGGGTGGGGGTAGGCGGCGGG - Intronic
1104058509 12:125248701-125248723 ATTTTTTGTGGGAAGGAGACTGG + Intronic
1104205123 12:126631690-126631712 CTTTGTTGGGGCAGTGAGGCTGG - Intergenic
1105253043 13:18718149-18718171 ATTTTTTGGGGGGAGGAGGGGGG - Intergenic
1105351932 13:19623696-19623718 CTTGGTGGGGAAAAGGAGGCAGG - Intergenic
1105428448 13:20315743-20315765 CTTTTTTGGGGGGTGGAGGGTGG + Intergenic
1105483604 13:20803700-20803722 CTTTGGTGGGGGGATGAGGGTGG - Intronic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1106125544 13:26897621-26897643 TTTTGCTGGGGGAAGGGGGCGGG + Intergenic
1106218181 13:27721717-27721739 CTTTGCTGAGGGAAGGGAGCAGG - Intergenic
1106840982 13:33684848-33684870 GTTTCTTGGGGGCAGGAGGGCGG - Intergenic
1106943862 13:34803727-34803749 CTTTGCAGGGGGAAGGAGCCTGG - Intergenic
1107460340 13:40595952-40595974 TTTTTTTGCGGGAAGGAGGTAGG + Intronic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1107634552 13:42379052-42379074 ATTTATTGGGGGAGGGTGGCTGG - Intergenic
1107988958 13:45800591-45800613 CTTTGTTGTTGGAAGCAGCCAGG + Intronic
1108413835 13:50177485-50177507 GTGTGTTGGGGGTAGGAGGTGGG + Intronic
1109894060 13:68659042-68659064 ATTTGTTGGGGGAAGAAGGGAGG - Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1111345596 13:86949808-86949830 GTTTGTTGGGAGACAGAGGCGGG + Intergenic
1111990633 13:95113187-95113209 CTTTTAGGGGGGAAGGAGGGAGG - Intronic
1113109102 13:106802843-106802865 GTGTGTTGGGGGGTGGAGGCGGG + Intergenic
1113461892 13:110487992-110488014 CTTTGTGGGAGGAAGGGGGAGGG - Intronic
1113740789 13:112711075-112711097 CGTATTTGGGGGAAGGAGGCAGG + Intronic
1114004787 14:18300797-18300819 CTGTGGTGGGGTTAGGAGGCGGG - Intergenic
1114251675 14:20967148-20967170 GAATGTTGGGGGAAGAAGGCAGG + Intergenic
1114302577 14:21391679-21391701 CTTCTTTGGGGGAGGGAGGGAGG + Intronic
1115683784 14:35771780-35771802 CCTTGTTGGGAGACTGAGGCAGG - Intronic
1115764070 14:36604714-36604736 GTTTGGTGGGGGTTGGAGGCAGG + Intergenic
1115766160 14:36625540-36625562 CTCTGTTTGGAGAAGGAAGCCGG - Intergenic
1116029102 14:39549546-39549568 TTTTGGTGGGGGATGGAGGATGG + Intergenic
1116861088 14:49996153-49996175 CTTTGTTGGAGGGAGAAGGAAGG + Intronic
1117410990 14:55450921-55450943 CTGAGCTGGGGGCAGGAGGCAGG + Intronic
1117430302 14:55652102-55652124 TTTTTTTGTGGGAAGGAGGTAGG + Intronic
1117639681 14:57785356-57785378 CATTGTCAGGGGAAGCAGGCAGG - Intronic
1117943927 14:60998133-60998155 CTTTGATATGGGCAGGAGGCAGG + Intronic
1118155148 14:63232990-63233012 CTTTATTGAGTGATGGAGGCTGG - Intronic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118730489 14:68662668-68662690 CTTTTTTGGAGGGAGGAGACAGG - Intronic
1119656067 14:76417965-76417987 TTTTGGTGGGGGATGGAGTCTGG + Intronic
1120189075 14:81423624-81423646 TTTTGTTGGGGGAAGAGGGAGGG - Intronic
1121266869 14:92609534-92609556 TTTTGTTGGGAGGAGTAGGCTGG + Intronic
1121464707 14:94107988-94108010 GCCTGTTGGGGGAAGGGGGCTGG - Intronic
1121719544 14:96099557-96099579 ACTTGTTGGGGGAAGGGGGGAGG + Intergenic
1121879502 14:97487389-97487411 CTTTGTGCAGGGAAGAAGGCTGG + Intergenic
1122402695 14:101476623-101476645 CATAGGTGTGGGAAGGAGGCAGG + Intergenic
1122793816 14:104195678-104195700 GCTTGTGGGGTGAAGGAGGCTGG + Intergenic
1122800713 14:104228234-104228256 CTTTGGTGGTGGCAGGAGGGTGG + Intergenic
1123101880 14:105809027-105809049 GTTTGTTGGGGGTAGGACACAGG + Intergenic
1123578628 15:21696495-21696517 CTTTCTTGGGTCAAGGTGGCAGG + Intergenic
1123615255 15:22138977-22138999 CTTTCTTGGGTCAAGGTGGCAGG + Intergenic
1123957887 15:25358371-25358393 ATTTTTTGGTGGAGGGAGGCAGG - Intronic
1123984638 15:25634443-25634465 CTTTCTTGGGGGAAGGGGCCTGG - Intergenic
1124014696 15:25864703-25864725 CATTGTTGGGGAAAGGAGTCAGG + Intronic
1125085199 15:35721737-35721759 CACTGTTGGGGGATGGCGGCAGG + Intergenic
1125258733 15:37798006-37798028 CTTTGAGAGGGGAAGGAGGCTGG - Intergenic
1126419493 15:48456409-48456431 GTGTGTTGGGGGAAAGGGGCTGG + Intronic
1126608428 15:50504277-50504299 CGTTTTTGGGGGATGGAGGTGGG + Exonic
1127147426 15:56038942-56038964 CAGTGTTGGGGGAAGGTGGGAGG - Intergenic
1127278414 15:57468061-57468083 CTTTGTTGGGGGAAGTCAGTGGG + Intronic
1128055793 15:64699358-64699380 GTTTTTTGGGGGAAGGGGGCAGG - Intronic
1128477543 15:68010130-68010152 CTCTGTTGGGCTAAGGAGGCTGG + Intergenic
1128494653 15:68188259-68188281 CTTTGTTGTGGGGAGGGGGTCGG + Exonic
1128619029 15:69133337-69133359 ATTTGTTGGTGGAAAGAGCCTGG + Intergenic
1129115826 15:73364838-73364860 CATTGCTGGGGGAGGAAGGCTGG - Intronic
1129951876 15:79599302-79599324 CTTTTTTTGGGGAGGGGGGCAGG - Intergenic
1130645773 15:85725375-85725397 CTTTTTTGGGGGGAGGGGGAGGG + Intronic
1130738202 15:86571866-86571888 GTTTCCTGGGCGAAGGAGGCAGG - Intronic
1131071682 15:89470141-89470163 CTCTGCTGGGGGAGGGAGGCTGG + Intergenic
1131336322 15:91552819-91552841 CTTTGCAGAGGGAAGGAGACTGG + Intergenic
1132390489 15:101434883-101434905 CTTTGTGGTGGGTAGGAGGTGGG - Intronic
1202987498 15_KI270727v1_random:430740-430762 CTTTCTTGGGTCAAGGTGGCAGG + Intergenic
1133000229 16:2846990-2847012 TTATGTTAGGGGAAGGAGGAGGG - Intergenic
1133041785 16:3064856-3064878 CTCAGCTGGGGGAAGGGGGCTGG + Intergenic
1133254984 16:4511269-4511291 CTTTTTTGAGGGAAAGAGGGTGG - Exonic
1133322574 16:4923420-4923442 CTCTCCTGGGGGCAGGAGGCCGG - Intronic
1133517852 16:6527355-6527377 CTTTGTTGGGGGAGGAAGGAAGG - Intronic
1134267440 16:12704251-12704273 GTTTATTGGGGGAAGTAGACTGG - Intronic
1134407177 16:13970641-13970663 CACTGCTGGGGGAAGGAGGAAGG + Intergenic
1135258681 16:20962666-20962688 CTTTTTTGGGGGGAGGGGGCAGG + Intronic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136791135 16:32968765-32968787 TTTTGGTGGGGGAGGGGGGCTGG - Intergenic
1136878679 16:33885167-33885189 TTTTGGTGGGGGAGGGGGGCTGG + Intergenic
1137268672 16:46888074-46888096 CTTTATTGGGGGATGGGGGTTGG + Intronic
1137282103 16:46986103-46986125 CTTTTTTGGGGGAATGGGGCGGG + Intergenic
1137784288 16:51125166-51125188 ATTTGATGAGGGAAGGAAGCAGG + Intergenic
1137815954 16:51397650-51397672 ATTTGTAGGGGGCAGGAGCCTGG - Intergenic
1138249097 16:55488796-55488818 CTGTCTTGGGGAAAGGAGGTGGG - Intronic
1138556682 16:57775050-57775072 GTTTGCTGGGGGTGGGAGGCGGG + Intronic
1139259843 16:65580814-65580836 TTCTGTTGGGTGAAGGAAGCTGG - Intergenic
1139301385 16:65948162-65948184 ATTTGTTGGGGGAGGAGGGCTGG - Intergenic
1139405165 16:66712224-66712246 CTTTGGGAGGTGAAGGAGGCAGG + Intergenic
1139747037 16:69083054-69083076 CTTGGGTTGGAGAAGGAGGCAGG - Intronic
1139869345 16:70092503-70092525 CTTTTTTGGGAGATGGAGGGAGG + Intergenic
1139936085 16:70572186-70572208 CTCTGTGGGAGGAAGGAGGCAGG + Exonic
1140386038 16:74539710-74539732 CTTTTTTGGGAGATGGAGGGAGG - Intronic
1141347152 16:83257119-83257141 CTGAGTTGGGGGATGGAGGAAGG + Intronic
1141670217 16:85487737-85487759 CGGTGGTGGGGGAAGGAGGTGGG + Intergenic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142120763 16:88385674-88385696 CTATGTTTGGACAAGGAGGCAGG - Intergenic
1142235720 16:88921589-88921611 TTTTGCTGGGGGAGGGAGGGGGG + Intronic
1203093344 16_KI270728v1_random:1230226-1230248 TTTTGGTGGGGGAGGGGGGCTGG - Intergenic
1142635086 17:1252104-1252126 CGCTGTTGGGGGAAGGGGGGAGG - Intergenic
1143497559 17:7321165-7321187 CTGAACTGGGGGAAGGAGGCTGG + Exonic
1143557214 17:7669411-7669433 TTTTGTTGTGGGGAGGAGGATGG - Exonic
1144029638 17:11308042-11308064 CTTTGGTGGGGTAAGGAAGTGGG + Intronic
1144204161 17:12967451-12967473 CTTTGTTGAGGAATTGAGGCAGG - Intronic
1144417781 17:15068290-15068312 CTTTTTGGGGGGAGGGGGGCAGG + Intergenic
1145023876 17:19453268-19453290 CTTCCTTGGGGGCAGGAGGCTGG - Intergenic
1146092585 17:29894826-29894848 CTTAATTGGGGGAAGGTGGAAGG - Intronic
1146516481 17:33493718-33493740 CTATCTTGGGGGAAGGATGGCGG - Intronic
1146581068 17:34039584-34039606 GTTTGCTGGGGGAAGCGGGCCGG - Intronic
1147210458 17:38870027-38870049 GTTTATTAGGGGAAGGAGGGCGG + Exonic
1147388001 17:40092898-40092920 CGGTGATGGGGGAGGGAGGCAGG + Exonic
1147629139 17:41918804-41918826 CCGGGTTGGGGGACGGAGGCAGG + Intronic
1148104502 17:45112222-45112244 CTCCTCTGGGGGAAGGAGGCTGG + Exonic
1148247923 17:46047615-46047637 CTTTGTAGGGGGCGGGAGGCGGG + Intronic
1149449804 17:56740680-56740702 CTTTGGTGGGGGAAGGAAGCTGG + Intergenic
1149550350 17:57535058-57535080 CTCTGTTGTTGGCAGGAGGCCGG + Intronic
1149661674 17:58337444-58337466 TCCTGTTGGGGGCAGGAGGCTGG - Intergenic
1149814809 17:59713250-59713272 GTGGGTTGGGGGAAGGAGGGAGG + Intronic
1149991836 17:61387759-61387781 CTTTCTTGGGGGATGGGGGTGGG + Intronic
1150245969 17:63675561-63675583 CTTCTTTGGGTTAAGGAGGCTGG + Intronic
1150602594 17:66663663-66663685 CTTTGTTGGGGGAGGGAGGATGG + Intronic
1150846997 17:68669207-68669229 AATTGTTGGGAGAAGGAGGGAGG + Intergenic
1151162335 17:72176031-72176053 ATGTGTTGGGGGAAGGGGGGAGG - Intergenic
1151382298 17:73734316-73734338 CTGGGCTGGGGGAAGGAGGGGGG - Intergenic
1151942203 17:77299926-77299948 CTCTGTTTGGGGTAGGAGGAGGG - Intronic
1152045124 17:77930413-77930435 CTTTGCTTCAGGAAGGAGGCTGG - Intergenic
1155721157 18:29013353-29013375 CTTATTTGGGGGAAGAGGGCAGG - Intergenic
1155765732 18:29629939-29629961 CTTTGTAGAAGGGAGGAGGCAGG - Intergenic
1155893685 18:31296677-31296699 CTTTGTTGGGAGGCCGAGGCGGG - Intergenic
1156560767 18:38122991-38123013 CATTGTTGGGGGTAGGAGGCAGG + Intergenic
1157312216 18:46560742-46560764 CTTTGTTGGAGGATGGGGCCAGG - Intronic
1157617077 18:48993303-48993325 GTTTGCTGGAGGAAGGAGGCAGG - Intergenic
1158973487 18:62689660-62689682 ATTTGTTTGGGAAAGTAGGCAGG + Intergenic
1159331110 18:66994921-66994943 ATTGGTTGGGGGTAGGATGCAGG + Intergenic
1160201668 18:76801619-76801641 CTTTGGGGGGCGAGGGAGGCAGG - Intronic
1160772840 19:840814-840836 CTTTGTGGGGGCGGGGAGGCTGG - Intergenic
1160845032 19:1162477-1162499 CGCTGTTGGGGGCAGGAGCCTGG + Intronic
1161283312 19:3457019-3457041 CGTGGATGGGGGATGGAGGCTGG - Intronic
1162017290 19:7852451-7852473 CCTTCGTGGGGGAAGGAGGATGG - Intronic
1162582848 19:11540912-11540934 CATAGTTGGGGGATGGGGGCTGG - Intronic
1162720117 19:12657244-12657266 TTTGGAGGGGGGAAGGAGGCGGG - Intronic
1162887658 19:13708008-13708030 GTTTGTTGGCAGAAAGAGGCAGG - Intergenic
1162964338 19:14148930-14148952 CTTTGTTGGGTTAAGGGGGAGGG - Exonic
1163084793 19:14971582-14971604 CTTTGTTTGGCCAAGGACGCTGG + Intronic
1163179140 19:15586457-15586479 CTGTGGTGGGGGCAGGAGGAGGG - Intergenic
1163836730 19:19579567-19579589 ACTTGCTGTGGGAAGGAGGCGGG - Intronic
1164836362 19:31357509-31357531 GGTGGTTGGGCGAAGGAGGCTGG - Intergenic
1165337631 19:35182855-35182877 CTTTGCTGGAGGAAGGAGCTGGG - Intergenic
1165667951 19:37649923-37649945 TATTGTTGGGGGAAGAAGACAGG + Intronic
1165761132 19:38321620-38321642 ATTTGTTGAGGAGAGGAGGCTGG + Intronic
1165818317 19:38657384-38657406 CTTTGTTGGGCCAAGGTGGGTGG - Intronic
1167105463 19:47427769-47427791 TTTAAGTGGGGGAAGGAGGCAGG - Intergenic
1167767015 19:51490336-51490358 CTGTGTGGGGAGAAAGAGGCCGG - Intronic
1168247535 19:55120470-55120492 TTTTCCTGGGGGAAGGAGGTTGG - Intergenic
925754850 2:7123435-7123457 CTTTTTTGGGGGCAGGGGGGCGG - Intergenic
926372137 2:12189323-12189345 CTTTGCTGGGGCAAAGTGGCAGG + Intergenic
926695503 2:15767727-15767749 CCATGTTAGGGGAAGGAGGGTGG - Intergenic
926754321 2:16223392-16223414 TGGTGTTGGGGGAGGGAGGCTGG - Intergenic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
927943117 2:27118381-27118403 CTTTCTTGGGGGATGGGTGCTGG - Intronic
928429200 2:31204020-31204042 CTGTTTTGGGGGTAGGAGGTTGG + Intronic
929439278 2:41952681-41952703 ATGTGCTGGCGGAAGGAGGCTGG - Intronic
930126487 2:47801810-47801832 TTTTGGTGGGGGAAGGGGGAAGG + Intronic
930403042 2:50915383-50915405 ATTTATTGGTTGAAGGAGGCAGG - Intronic
930768131 2:55105723-55105745 CTTTGGGAGGGGAAGGAAGCAGG + Intronic
931486645 2:62700425-62700447 CTATGTTGGGGGAAGGGGATGGG + Intronic
931788692 2:65644220-65644242 CTTTGTTGGTGGAAAAAGCCAGG + Intergenic
931959235 2:67463676-67463698 CTTTCTTGTGGGAAAGTGGCTGG - Intergenic
932301790 2:70672621-70672643 CTGAGTTGGGGCAAGGAGCCGGG + Intronic
932837402 2:75050453-75050475 CTCTGGATGGGGAAGGAGGCGGG - Intronic
934708686 2:96501816-96501838 CTGGGCTGGGGGAGGGAGGCTGG + Intronic
934925922 2:98381725-98381747 CTGGGCTGGGGGAAGGAGGCTGG + Intronic
935193538 2:100797208-100797230 CTTTGTTTGGCCAAGTAGGCAGG + Intergenic
936009094 2:108913627-108913649 TATTGTTGTGGGAAGGAGGCTGG + Intronic
936419538 2:112350082-112350104 CAGTGTTGGGAGACGGAGGCTGG + Intergenic
936577524 2:113668678-113668700 GTTCGGTGGGGCAAGGAGGCAGG - Intergenic
937111847 2:119372700-119372722 CTTTGTGGGGAGGAGGAGGATGG + Intergenic
937231047 2:120398429-120398451 CTATGTGGGAGGCAGGAGGCAGG + Intergenic
937680249 2:124635764-124635786 CCTTGTTCTGGGAAGTAGGCAGG + Intronic
937989026 2:127652073-127652095 TTCTGTAGCGGGAAGGAGGCTGG - Exonic
938954184 2:136283097-136283119 CTTGGGTGGGGGAGGGTGGCTGG - Intergenic
941224320 2:162827251-162827273 CTTTCTTGTGGGAAGGAGAGGGG + Intronic
941511612 2:166417459-166417481 TTTTGTGGGGGGATGGAGTCTGG - Intronic
942116509 2:172734765-172734787 GTTTGGTGGGGGGAGGAGGCAGG + Intergenic
943560360 2:189454176-189454198 CTGTGTTGGAGAAGGGAGGCCGG + Intronic
944868281 2:203883768-203883790 CTGGGCTGAGGGAAGGAGGCTGG + Intergenic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
945151999 2:206801359-206801381 TGGTGATGGGGGAAGGAGGCTGG + Intergenic
945572993 2:211494015-211494037 CTATGTTGGGGAAATAAGGCTGG - Intronic
947144300 2:227050762-227050784 CTATGTTAGGGGAACCAGGCAGG + Intronic
1169127314 20:3138847-3138869 CTTTGTAGGCTGAAGGAAGCTGG - Intronic
1169190910 20:3658803-3658825 CTTTGGAGGAAGAAGGAGGCAGG + Intergenic
1169218448 20:3806765-3806787 ATTTCTTGAGGGAATGAGGCTGG - Intergenic
1169388435 20:5170292-5170314 CTTTCTTGTGGGAAGGAGCATGG + Intronic
1170904144 20:20497062-20497084 CTTTTATGTGGGAAGGAGGAAGG - Intronic
1171117313 20:22536217-22536239 CTTTGGTGGGGTTAGGTGGCTGG - Intergenic
1171333782 20:24364533-24364555 CTTTGTTGAGGGAGGGAGGGTGG + Intergenic
1172328653 20:34058076-34058098 CTTTTTGAGGGGAAGGGGGCCGG + Intronic
1172368665 20:34369858-34369880 CTTTGTGGGGCGAAGGTGGGAGG + Intronic
1172706151 20:36883507-36883529 CTTTGATGGGGGAAGATAGCAGG - Intronic
1173290724 20:41712685-41712707 CTGTGTTTAGGGAAGCAGGCTGG - Intergenic
1173353691 20:42267698-42267720 CTTTGTTGGGGGCCGGTGGCAGG - Intronic
1173694437 20:44996473-44996495 CTTTTTTGGGAGAAGGAGTGAGG + Intronic
1173787983 20:45808872-45808894 CTTTGTTGTGAGAAGGGGGTGGG + Intronic
1173939546 20:46898210-46898232 TTTTGTTGGTGGAAGGAACCGGG + Intronic
1174535091 20:51245214-51245236 GGTGGTTGGGGGAAGAAGGCAGG + Intergenic
1176214737 20:63942655-63942677 CTTGGTCGGGGGCAGGAGGGAGG - Intronic
1176674051 21:9760642-9760664 CTTAGTAGGAGGAAGGAGGGGGG - Intergenic
1177762682 21:25419723-25419745 CTTTGTTAGAGGAAGCAGGATGG - Intergenic
1177819632 21:26016925-26016947 CTTTGTGGGGGGCGGGGGGCGGG + Intronic
1178351702 21:31876217-31876239 CTTTGGGTGGAGAAGGAGGCAGG + Intronic
1178696622 21:34798202-34798224 GTGTGTTGGGGGAACGGGGCGGG - Intronic
1179442770 21:41407076-41407098 CTTTGCTGAGGGAAGGAGGGAGG + Intronic
1179605967 21:42515093-42515115 CTTTGTTGGGGGTTGGAGGCAGG + Intronic
1180002081 21:44999738-44999760 CTGTGTTGGTGGCAGGTGGCCGG + Intergenic
1180882006 22:19210974-19210996 CTTTGTGGGGGCAAGGTGGGAGG - Intronic
1182019026 22:27065446-27065468 CTTTTAAGGAGGAAGGAGGCAGG - Intergenic
1182246124 22:28959151-28959173 TTTTCTTGGAGGAAGAAGGCAGG + Intronic
1182287398 22:29256532-29256554 TTTTGCTGGATGAAGGAGGCTGG - Intronic
1182427742 22:30283797-30283819 TTTTGTTGGGGGAGGGGGGTTGG - Intergenic
1182850978 22:33473994-33474016 CTTTGGAGGGGAAAGGAGGTTGG + Intronic
1183748556 22:39706068-39706090 CTTTGGTGGTGGTGGGAGGCAGG + Intergenic
1184102709 22:42349147-42349169 CCTTGCTGGGGGAAGGAGCTGGG - Intergenic
1184417986 22:44363288-44363310 CTTTGTGGGGGCAGGGAGGGCGG + Intergenic
1184704884 22:46204018-46204040 GTTTACTGGGGGAGGGAGGCAGG - Intronic
1185009351 22:48304647-48304669 TTTTGATGGGGGAAGGGGGATGG - Intergenic
1185135630 22:49070447-49070469 CTGTGGTGGGGAGAGGAGGCTGG + Intergenic
1185422706 22:50743986-50744008 GTTCGGTGGGGCAAGGAGGCAGG + Intronic
949238142 3:1836131-1836153 CTTTTTTTGGGGGAGGGGGCGGG + Intergenic
949358012 3:3202269-3202291 CTTTGTTGGGGGTCGGGGGAGGG + Intergenic
949571655 3:5299777-5299799 CTTTGCAGCGGGAAGGAGCCTGG - Intergenic
949782003 3:7700236-7700258 TGTTGTTGGGAGAGGGAGGCAGG - Intronic
950471809 3:13190997-13191019 GTGTGTTGGGGGCAGGAGGAGGG - Intergenic
950677232 3:14561666-14561688 ATTTGTTTCGGGAAGCAGGCGGG - Intergenic
951697097 3:25456336-25456358 CTTTCTTGGGGGGTGGAGGAAGG + Intronic
952409064 3:33031214-33031236 CTTTGATGAAGGAAGGAGGCAGG + Intronic
952890555 3:38037447-38037469 CTATGGTGGGGGGAGGAGGAGGG - Intergenic
952929271 3:38346968-38346990 CTTCGGTGGGGGTAGGGGGCGGG + Intronic
953418812 3:42739344-42739366 ATGTATTGGGGGAAGGAGGTGGG - Intronic
954201770 3:49027545-49027567 CTCTGGTGGGGAAAGGATGCAGG + Intronic
954762558 3:52887263-52887285 CTTGGGAGGTGGAAGGAGGCTGG - Intronic
955366863 3:58318228-58318250 CTTAGTTAGGGGAAGGGAGCAGG + Exonic
955514693 3:59715143-59715165 CTTGGATGGGGGAAGCAGGGAGG - Intergenic
956064968 3:65388417-65388439 CTGTCTTGGGGGGAGGGGGCAGG + Intronic
956165785 3:66397256-66397278 CTCAGTTGGGGCAGGGAGGCTGG - Intronic
956251836 3:67242166-67242188 CTTTTTGGTGGGAAGGAGGGTGG + Intergenic
957194052 3:77045042-77045064 CAATGTTGGGGGAGGGAGGCGGG + Intronic
957619844 3:82581523-82581545 CTTTGCAGGGGAAAGGAGCCTGG - Intergenic
960046928 3:113208228-113208250 CTTGGTCGGGGGAAGGAGTGGGG - Intergenic
960093887 3:113669366-113669388 CTATGTTGGGGTTAGGAAGCAGG + Intronic
961096517 3:124161167-124161189 CTTTTTTGGGGGAGGGATGGAGG - Intronic
962149888 3:132881534-132881556 CTTTTTGGGGGGAAGGTGGGAGG + Intergenic
962491401 3:135897194-135897216 CTTTTTGGGGGGTGGGAGGCAGG - Intergenic
962768661 3:138592541-138592563 GATTGTTGGGGGTAGGAGTCGGG + Intronic
962949188 3:140202471-140202493 CTGAGTTGGAGGAAGGATGCGGG + Intronic
962971764 3:140407990-140408012 CTTTGTCGGGGAATGAAGGCTGG - Intronic
963835804 3:150056743-150056765 CTTTGTTGTGGCAAGGAGGAGGG + Intergenic
964144449 3:153441985-153442007 CTTTCCTGGGGGAGGGAGGAAGG - Intergenic
964445782 3:156755839-156755861 CTTTTTTGGGGGTGGGAGGGGGG + Intergenic
964647531 3:158974231-158974253 ATGTGTTGTGGGGAGGAGGCTGG - Intronic
965608898 3:170524399-170524421 CTGTGATGGGGGTAGGTGGCAGG + Intronic
967482050 3:189983925-189983947 CTTTCTTGGGGGAAGGGGAGAGG + Intronic
967979844 3:195059196-195059218 CTGAGGTGGGTGAAGGAGGCGGG - Intergenic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
968550960 4:1223183-1223205 GTTTGTTGAGGGGAGGAGGGAGG - Intronic
968614816 4:1572653-1572675 CTTGGTCGGGGGAAGGGGGCTGG + Intergenic
969716370 4:8870215-8870237 CTGTGTTGGGGGTGGGGGGCTGG + Intronic
970051719 4:11922079-11922101 CTGTGTTGGAGTAAGAAGGCCGG - Intergenic
970555997 4:17232963-17232985 ATCTGTTGGGAGAAGGAGGTTGG - Intergenic
970831699 4:20347235-20347257 CTCTGTTAGGTAAAGGAGGCAGG + Intronic
971341590 4:25774397-25774419 GTTGGTTGGGGGAAGGAGAAAGG - Intronic
971466323 4:26966295-26966317 CTTTGTTTTGGGAAAGAGGTGGG + Intronic
972507130 4:39730427-39730449 CTTTGTGGGGCAAAGGAGGGAGG - Intronic
975545882 4:75560109-75560131 TTTTGGAGAGGGAAGGAGGCAGG + Intronic
975591475 4:76004383-76004405 CTTTGCTGGGGGAATGGGGCAGG - Intronic
975800967 4:78058657-78058679 TTTTGTTCTGGGAAGCAGGCTGG - Intronic
977255511 4:94736072-94736094 CCTAGGTGGGAGAAGGAGGCTGG + Intergenic
977775163 4:100909533-100909555 TTTTGTTGGGGGAAGGAGTATGG + Intergenic
978077602 4:104552603-104552625 TTTTCTTGGGGGAAGGGGGCTGG - Intergenic
979464215 4:121017759-121017781 CTTTGTAGGGCCAAGGAGGGAGG - Intergenic
979525188 4:121708733-121708755 CTTTGTTGGGGAATGGGGGTAGG + Intergenic
979832928 4:125322675-125322697 CTTTTTTGGGGGGAGGAGGTGGG + Intronic
980524818 4:133976105-133976127 CTCTGTTGGGGGAAGGTGGCAGG - Intergenic
981003679 4:139853434-139853456 TTTGGTTGGGGGAGGGAAGCAGG + Intronic
981192897 4:141884221-141884243 CATTGTTGTGGGATGGAGGGTGG + Intergenic
981536749 4:145808226-145808248 CTTTGTTAGAGTATGGAGGCAGG - Intronic
982033163 4:151321169-151321191 CTTGGGTGGGGGAAGAAGGGAGG - Intronic
982827766 4:160022009-160022031 CTTTGCTGCGGGAAAGAGGTTGG - Intergenic
983192879 4:164773192-164773214 CTTGGTAGGGAGAAGGAGGCTGG + Intergenic
984993636 4:185406448-185406470 ATTTTTTGGGGGAAGGTGCCCGG + Intronic
985269834 4:188183657-188183679 GTTTGATGGGGACAGGAGGCAGG + Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985776680 5:1847985-1848007 CTTTGGTGTTGGGAGGAGGCTGG + Intergenic
985776695 5:1848069-1848091 CTTTGGTGGTAGAAGGAGGCTGG + Intergenic
985776760 5:1848420-1848442 CTTTGGTGGTGGGAAGAGGCTGG + Intergenic
985776810 5:1848599-1848621 CTTTAGTGGTGGGAGGAGGCTGG + Intergenic
985970398 5:3373603-3373625 ATGTGTTGTGGGATGGAGGCTGG + Intergenic
986210619 5:5667972-5667994 CTTTGTTGGGGCGAGGCTGCTGG + Intergenic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
986859094 5:11904777-11904799 GTGGGTTGGGGGAGGGAGGCTGG + Intergenic
987037431 5:14032355-14032377 CTTTGGTGGGGGTATGAGGAGGG - Intergenic
987444240 5:17997846-17997868 CTAGGTTGGGGGAAGAATGCAGG - Intergenic
989240804 5:39201587-39201609 TTTTGTTGGGGGAAGGGAGAGGG - Intronic
990036735 5:51330927-51330949 CTGTGGTGGGGGGAGGAGGGGGG - Intergenic
990283552 5:54277257-54277279 TTTTGCGGGGGGAGGGAGGCAGG - Intronic
990598562 5:57334699-57334721 CTTTGGTAGAGGAAGGTGGCTGG - Intergenic
991932357 5:71766229-71766251 CTTTGTGAGTGGGAGGAGGCAGG + Intergenic
991969574 5:72126116-72126138 CTGTGTTGAGGGAAGCAGGGAGG + Intronic
992523153 5:77577302-77577324 TTTGGTGGGGGGAAGGGGGCAGG - Intronic
992893427 5:81225864-81225886 CTTTGGTGGAGAAAGGAGCCTGG - Exonic
993563450 5:89441839-89441861 ATTTGATTGGAGAAGGAGGCAGG - Intergenic
994852676 5:105075788-105075810 CTTTGCCTGGGGAAGGAGCCTGG - Intergenic
997844562 5:137275280-137275302 CTATGGTGGGGGAAGGGAGCAGG - Intronic
998037924 5:138932392-138932414 CTCTGCTTGGGGATGGAGGCGGG - Intronic
998298256 5:140992748-140992770 CTGTGTTGGGGATAGGAGGGTGG + Intronic
999188310 5:149729231-149729253 GTTTTTTGGGGGAAGGGTGCTGG + Intergenic
999519799 5:152339545-152339567 CTTAATGGGGGGATGGAGGCAGG + Intergenic
1001024273 5:168210288-168210310 CTATGTTGGGGGAAGGAGAAGGG - Intronic
1001392310 5:171388587-171388609 CGTGGTTGGGGGAGGGAGGGGGG + Intronic
1002635162 5:180603656-180603678 CTTTGCTGGGAGACCGAGGCGGG + Intronic
1002921271 6:1575173-1575195 CCTTGTTGGGGGGTGGAGGGGGG - Intergenic
1003514115 6:6804247-6804269 CTATGGGAGGGGAAGGAGGCAGG + Intergenic
1003676585 6:8210324-8210346 CTTATTTAGGGGAAGGAGGTCGG - Intergenic
1003930265 6:10918084-10918106 CTTTGTTGGGAGGTTGAGGCTGG + Intronic
1004026104 6:11820189-11820211 TTTTTTTGGGGGATGGGGGCAGG - Intergenic
1004100209 6:12601966-12601988 TTTTGGTGGGGGAAGGCGGTGGG - Intergenic
1004206238 6:13594127-13594149 GTTTGTTGGCGGAAGGATCCAGG + Intronic
1005041894 6:21607613-21607635 GTGTGTTGGGGAAAGGATGCAGG - Intergenic
1005055204 6:21722658-21722680 GTTTGCAGGGGGAAGGAGACAGG - Intergenic
1005192294 6:23238673-23238695 GTTTGTTGGGTGAAGGTGGATGG + Intergenic
1006143531 6:31945076-31945098 CCTTGTTGGGGGGATGAGGGAGG + Intronic
1006376316 6:33673499-33673521 CTTTATGGGGGGCAGGGGGCAGG - Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006461556 6:34162117-34162139 CTCTGATGGGGGAAGGAGTTGGG + Intergenic
1006879950 6:37330897-37330919 CTGTTTGGGAGGAAGGAGGCTGG + Intronic
1006906613 6:37537320-37537342 CTTTGGTGGGTGAAGGAGGGTGG + Intergenic
1007244401 6:40450164-40450186 CAGTGGTGGGGTAAGGAGGCCGG - Intronic
1009289847 6:61868612-61868634 CTTTGCTGGGGGCAGGGGTCGGG + Intronic
1009544910 6:65009191-65009213 CTTTGGTAGGGAAAGGAGGTGGG - Intronic
1010932503 6:81819595-81819617 CCGAGTTGGGGGAAGAAGGCTGG - Intergenic
1012125660 6:95425210-95425232 TTTTGTTGGGGAAAGGAGAATGG - Intergenic
1013111190 6:107066688-107066710 GGTTGTTGGGGGCTGGAGGCGGG - Exonic
1013273673 6:108562887-108562909 CTGTCTTGGGGGAAGGGGCCAGG - Intronic
1013813833 6:114074137-114074159 CCTGTTTGGGGGTAGGAGGCTGG + Intronic
1013988548 6:116225928-116225950 CTTTGGAGGGGGGTGGAGGCTGG + Intronic
1014320590 6:119924088-119924110 ATTTGTTGAGGGAAAGAAGCTGG + Intergenic
1014348559 6:120309090-120309112 CATTGTGGGGGAAAGGAGGCTGG - Intergenic
1014674706 6:124349283-124349305 CTTTGTAGGGGGGAGCAGGCTGG - Intronic
1015445469 6:133299034-133299056 CTGTGGTGGGGGAATGAAGCAGG + Intronic
1015541056 6:134314339-134314361 CTTGGTTGGGGGAGGGGGGTAGG + Intronic
1015976571 6:138796606-138796628 CTGGGTTGGGGGAATGAGGGAGG + Intronic
1017641380 6:156497594-156497616 CTTTCTTGGGGGAAGTAGTCTGG - Intergenic
1018926436 6:168209932-168209954 CTCTGTGGGGAGCAGGAGGCCGG - Intergenic
1019273901 7:166053-166075 CTGTGATGGGGGGAGGTGGCTGG + Intergenic
1019442745 7:1055693-1055715 CTCTGTGGGGTGAAGGTGGCCGG + Intronic
1019631941 7:2054086-2054108 CTGTGTTGGGGGAGGTGGGCTGG - Intronic
1019641517 7:2106132-2106154 CTGTGCTGGGGGTGGGAGGCGGG - Intronic
1019827795 7:3299138-3299160 CTTTGCTGGGAGATAGAGGCTGG - Intergenic
1019982649 7:4632786-4632808 TTTTGTGGGGGGAAGGTGGCAGG + Intergenic
1020748770 7:12112253-12112275 CTTTGGGAGGGGAAGGAAGCAGG - Intergenic
1021073506 7:16273107-16273129 CTTTGATGGGGGGAGGGGGGAGG - Intronic
1021196772 7:17682466-17682488 CTTTGTTGGGAGGATGAGGCGGG + Intergenic
1021387552 7:20050446-20050468 CTTCACTGGGGGAATGAGGCTGG - Intergenic
1021710141 7:23407934-23407956 ATTTGTGGGGGGCAGGGGGCGGG + Intronic
1021777970 7:24072476-24072498 ATGGGCTGGGGGAAGGAGGCTGG + Intergenic
1021979341 7:26039532-26039554 CTTTGTTGGGGCTGGGCGGCAGG + Intergenic
1022109434 7:27219504-27219526 CTGAGTTGGGGGAAGGGGGGAGG + Intergenic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1022318444 7:29265630-29265652 CTTTCTTGGAGGCAGGAGGCAGG + Intronic
1022889371 7:34681156-34681178 CTTGGTCTGGGGATGGAGGCAGG - Intronic
1025698937 7:63798215-63798237 CTTTGGTGGGTGAAGGTGGGAGG - Intergenic
1026140188 7:67699065-67699087 CTCTGTTGGGGGAAGTGGGGTGG + Intergenic
1026174443 7:67983829-67983851 CTTTGGGGGAGGAAGGAGGGAGG + Intergenic
1026298664 7:69078262-69078284 CATTCTTGAGGGAATGAGGCAGG - Intergenic
1026800693 7:73397985-73398007 CCTTGTTGGGGGTGGGGGGCGGG + Intergenic
1027744598 7:82057441-82057463 ATGTGTTGGGGGAAAGGGGCAGG + Intronic
1028405636 7:90470821-90470843 GTTTGTTGGGAGAAGGGGCCAGG - Intronic
1029278007 7:99418987-99419009 CTCTGGTGGGGGAAGAGGGCAGG - Exonic
1029433277 7:100546264-100546286 CCTTGTTAGGGGGAGGAGGCAGG - Intronic
1030713903 7:112787374-112787396 CTTTTTTGGGGGGAGGGGGAAGG + Intronic
1032271177 7:130408087-130408109 CTTCCCTTGGGGAAGGAGGCAGG - Intronic
1033005272 7:137554759-137554781 CTTTGTTCCAGGAATGAGGCTGG - Intronic
1033388630 7:140904434-140904456 CTTTTTTGGGGGAGGCAGGGAGG + Intronic
1034105345 7:148484970-148484992 TTTTGGTGGAGGATGGAGGCTGG + Intergenic
1035168273 7:157004096-157004118 CATCGATGGGGGAAGGGGGCCGG + Intronic
1035417949 7:158705134-158705156 CGGTGTTGTGGGAAGGAGGAAGG + Intergenic
1035761514 8:2072231-2072253 CTTTTTTGGGGGCGGGGGGCGGG - Intronic
1036185078 8:6615499-6615521 CTGAGTTGGGGGCAGGAGGCAGG + Intronic
1036826971 8:11984890-11984912 CTTTTGTGGGGGCAGGATGCTGG - Intergenic
1037134119 8:15441950-15441972 CTATTTTGGGGGAATGAGACCGG - Intronic
1037789083 8:21920307-21920329 CGTGGGAGGGGGAAGGAGGCCGG - Intronic
1038126580 8:24679976-24679998 CTTTGTTGCCGGAAGGGGCCCGG - Intergenic
1038270908 8:26074986-26075008 CTTTGTTGTTGAAAGGAGCCTGG - Intergenic
1038403450 8:27304382-27304404 GTTAGTTGGGGGAAGCAGGTGGG - Intronic
1038608222 8:29032264-29032286 CTTTTTTGGGGGTGGGAGGAGGG + Intronic
1038839914 8:31174943-31174965 CTATTTTGGGGGACTGAGGCGGG - Intergenic
1039816112 8:41095916-41095938 TTTGGTTGGGGAAAGGAGGCTGG - Intergenic
1039816170 8:41096297-41096319 TTTCGTTGGGGAAAGGAGGCTGG - Intergenic
1041340071 8:56835619-56835641 GTTTGTGGGGGGAAGGAGGAAGG - Intergenic
1041367301 8:57121587-57121609 TTTTGTAGGGTGAAGAAGGCAGG - Intergenic
1042036755 8:64541655-64541677 CTTTGTTGTGGGATGGGGGCAGG - Intergenic
1042191796 8:66194551-66194573 CTCTGGTCGGGGAAGGAGGAAGG + Intergenic
1043455248 8:80406166-80406188 CTTTGTGGGGCCAAGGAGGGAGG - Intergenic
1045035011 8:98170072-98170094 CTTTATAGAGGGAAGGAGGTCGG + Intergenic
1045105137 8:98885219-98885241 CTGTGCTGGGGCAAGGAGGCAGG - Intronic
1045593403 8:103625106-103625128 GTTTTTAGGGGGAAGGAGGTTGG + Intronic
1045970206 8:108071510-108071532 CTATGCTGGGTGAAGGAGGGCGG + Intronic
1046066476 8:109202893-109202915 CTTTGCAGTGGGAAGGAGCCTGG - Intergenic
1046069217 8:109230313-109230335 CTTTGTTGGGAGGCCGAGGCGGG - Intergenic
1046552967 8:115739677-115739699 ATTTGTTGGAGGAAGCACGCAGG - Intronic
1046581115 8:116093558-116093580 TTTTGCTGGGGGCAGGAGGTGGG - Intergenic
1047213095 8:122855457-122855479 CTTTCTTGGAGCAAGGGGGCAGG + Intronic
1047215005 8:122869180-122869202 CTTTCTCCTGGGAAGGAGGCAGG - Intronic
1047274682 8:123396558-123396580 ATTTGTAGAGCGAAGGAGGCCGG + Intronic
1048298502 8:133234294-133234316 GTATGTGGGGGGAAGGGGGCAGG + Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1049368265 8:142251324-142251346 TTTTGTGGGGGGAGGGGGGCGGG - Intronic
1050038933 9:1466816-1466838 CTGAGTTGGAGGAAGGAGGGAGG + Intergenic
1050387952 9:5110825-5110847 GTTTGTTCGGGGAAGGTGGGGGG + Intronic
1051434518 9:17016828-17016850 GTTTGCAGGGGGAAGGAGCCTGG - Intergenic
1052374713 9:27706028-27706050 TTTTGTTGGGGGTGGGGGGCAGG + Intergenic
1052488609 9:29133928-29133950 CTTTAGTGAGGGAAGGAGGGAGG - Intergenic
1053174062 9:35909812-35909834 CTTTAGTGGGGGCTGGAGGCAGG - Intergenic
1054771834 9:69090557-69090579 CTGGGTTGGGGGAGGGAGGAAGG + Intronic
1054816011 9:69476196-69476218 CTTGGCTGGGGGAAAGGGGCCGG + Intronic
1056271721 9:84953989-84954011 AATAGTTGGGGGAAGGAGGGCGG + Intronic
1056975250 9:91247023-91247045 GATTGTCGGGGAAAGGAGGCAGG - Intronic
1057537270 9:95924028-95924050 CTCTGTTGTTGCAAGGAGGCAGG - Intronic
1057594032 9:96399331-96399353 CTTTTTTGGGGGATGGTGGAGGG + Intronic
1058179272 9:101777655-101777677 CATTGTTGGGGGAAGGTGGTGGG - Intergenic
1058893380 9:109380051-109380073 TTGTGTTGGGGTAAGGAGTCTGG + Intronic
1059382931 9:113942382-113942404 CTTTGTTGAAGGTAGGACGCAGG + Intronic
1059455010 9:114394918-114394940 CTTTTTCTGGGGAAGGAGCCTGG - Intergenic
1059614273 9:115931931-115931953 CCTTGTTGGGACTAGGAGGCAGG + Intergenic
1060298264 9:122357611-122357633 CTTTGTTGTTGGAAGGAAGGAGG + Intergenic
1060514926 9:124259585-124259607 CCTTGATGGGGGAAGGAGAGGGG - Intronic
1060770455 9:126327872-126327894 CTTGGGTGGGGGCAGGAAGCAGG - Intronic
1060812898 9:126619814-126619836 CTTGAGTGGGGGAAGCAGGCTGG + Intronic
1062271694 9:135712790-135712812 CTCTGTGGGGGGAACAAGGCAGG + Intronic
1062479353 9:136744286-136744308 CTCTCTTGGGGGAAGGGGGTGGG - Intronic
1203455228 Un_GL000219v1:160822-160844 GTGGGTTGGGGGAAGGGGGCAGG - Intergenic
1186612313 X:11149457-11149479 GTGTGTTGGGGGAGGGGGGCAGG + Intronic
1187828315 X:23355024-23355046 CTTTTTTGGGGGGAGGGGGGAGG + Intronic
1187988548 X:24842980-24843002 GTGTATTGGGGGAGGGAGGCAGG - Intronic
1188129436 X:26413145-26413167 CTTTTTTGGGGGGGGGGGGCAGG + Intergenic
1188691462 X:33134167-33134189 CTCTGTTTGATGAAGGAGGCTGG - Intronic
1189231289 X:39454308-39454330 CTTTGTTGGGGTAAGGAGGGAGG - Intergenic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1190736138 X:53256833-53256855 CTCAGCTGGGGGAAGGGGGCAGG + Intronic
1191154762 X:57261307-57261329 CTTTGTTAGGGCAAGGCGGGTGG + Intergenic
1192244967 X:69364478-69364500 CTTTGTTAAGGGAAGGATGGAGG - Intergenic
1192839141 X:74836069-74836091 CCATGGTGGGGGAAGGAGGAGGG + Intronic
1192875362 X:75223706-75223728 CACTGCTGGGGGATGGAGGCGGG + Intergenic
1193437615 X:81496486-81496508 CTTTGTTGGGGGCAGGGGGAGGG + Intergenic
1194598700 X:95892569-95892591 GTGTGTTGGGGGAGGAAGGCGGG + Intergenic
1194809654 X:98375029-98375051 CTTTGCAGGGGGGAGGAGCCTGG - Intergenic
1194877670 X:99209060-99209082 CACTGTTGGGGGATGGAGGAGGG + Intergenic
1195447441 X:104970727-104970749 CTTTGAAGGGGGAATGAGGTAGG - Intronic
1195526445 X:105895675-105895697 ATTTGTTTGGGAGAGGAGGCGGG + Intronic
1195698342 X:107683268-107683290 ATTTAGTGGGGGAAGGAGGAGGG - Intergenic
1195997449 X:110745436-110745458 CTGTGTAGGAGGGAGGAGGCTGG - Intronic
1196048087 X:111276930-111276952 CTGTGTTGCGGGAGGGAGGTGGG + Intergenic
1196824172 X:119728013-119728035 CTTAGTTGGGAGACTGAGGCAGG - Intergenic
1197828160 X:130612846-130612868 CTTTGTTGGTGGCATGAGGAGGG + Intergenic
1198341279 X:135715850-135715872 ATCTGTTGGGGGAGGGGGGCTGG - Intronic
1198790698 X:140342465-140342487 CTGTGGTGGGGGAAGAAAGCAGG + Intergenic
1198939189 X:141934448-141934470 ATTTGTAGGGGGTAGGAGCCTGG + Intergenic
1201423910 Y:13828718-13828740 CTTTTTTGGGGGAGGGGGGAGGG + Intergenic
1201646022 Y:16232734-16232756 CTTTGGTAGAGAAAGGAGGCGGG - Intergenic
1201656791 Y:16352579-16352601 CTTTGGTAGAGAAAGGAGGCGGG + Intergenic