ID: 1189852993

View in Genome Browser
Species Human (GRCh38)
Location X:45195383-45195405
Sequence ACCCTATGTTGAGGGACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189852993_1189853002 -10 Left 1189852993 X:45195383-45195405 CCCCAAGTCCCTCAACATAGGGT 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1189853002 X:45195396-45195418 AACATAGGGTGGGGGTGTAGAGG 0: 1
1: 0
2: 1
3: 25
4: 356
1189852993_1189853003 6 Left 1189852993 X:45195383-45195405 CCCCAAGTCCCTCAACATAGGGT 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1189853003 X:45195412-45195434 GTAGAGGAGAGCAACAGCTTTGG 0: 1
1: 0
2: 0
3: 20
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189852993 Original CRISPR ACCCTATGTTGAGGGACTTG GGG (reversed) Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902653283 1:17850838-17850860 ACCCTATGGCGAGGCCCTTGTGG + Intergenic
902696270 1:18142968-18142990 ACCCTTTGGGTAGGGACTTGGGG - Intronic
903163748 1:21507173-21507195 TCCCGAGGTGGAGGGACTTGAGG + Intergenic
903765117 1:25729092-25729114 TCTCTATGTTGAGGGCCATGAGG - Intronic
906919603 1:50048996-50049018 AACATATGTTAAGGGACTTGAGG + Intronic
909476050 1:76082012-76082034 AACCTTTGTTGAAGGACTAGTGG + Intronic
910434364 1:87190316-87190338 AGCCTATGTTTAGTGATTTGGGG + Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912164675 1:107029323-107029345 ACTCCATGTTGATGGCCTTGGGG - Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915844238 1:159247090-159247112 TCCCTGGGTTGAGGGCCTTGTGG + Intergenic
917642028 1:176992151-176992173 ACTCTGCATTGAGGGACTTGGGG - Intronic
1063054968 10:2495046-2495068 ACCCTATGTTGATGTTTTTGAGG - Intergenic
1070991588 10:80737902-80737924 ACCCAATGTTGAGGAACCTGGGG - Intergenic
1075444196 10:122502561-122502583 TCCCTCTGTTGAGAGACTTCTGG + Intronic
1079346572 11:19657646-19657668 ACCAGATGTGGAGGGCCTTGAGG + Intronic
1080516148 11:33022456-33022478 ATCCTATTTTGAGGAAATTGAGG - Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1092071820 12:5637427-5637449 ATCCTTTGTTTAGGGTCTTGTGG + Intronic
1092298335 12:7220525-7220547 GCTCTATGTTCAGGGACTTAGGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1106185821 13:27408805-27408827 ACGCAATGTGCAGGGACTTGAGG + Intergenic
1106432949 13:29699075-29699097 ACCCACTGTTGAGAGACTTGAGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1110387087 13:74925447-74925469 AGCCTGTGTTGAGAGATTTGTGG - Intergenic
1110641364 13:77828443-77828465 ACTCTCTGATGAGGGACTAGGGG + Intergenic
1112788475 13:102977917-102977939 ACCCAATGTTCAGTGACTGGTGG - Intergenic
1117163505 14:53011726-53011748 ACCCTATGTTGAAGGTCTTTAGG + Intergenic
1118629806 14:67692397-67692419 AGACTATGTTGTGGGTCTTGAGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120763353 14:88305896-88305918 ACCCAAGGCTGAGGGAATTGGGG + Intronic
1127375687 15:58382474-58382496 ACCCTAAGTGGAGGGACCTCTGG + Intronic
1129597553 15:76976386-76976408 ATCCTATGCCTAGGGACTTGGGG - Intergenic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1132075962 15:98820161-98820183 ACCCCAAGTTGATGGCCTTGTGG + Intronic
1136290192 16:29267136-29267158 CCCCTATGTTGAGGGCTCTGGGG - Intergenic
1139319105 16:66098771-66098793 ACCCAATGCTGATGAACTTGTGG + Intergenic
1141404596 16:83781139-83781161 TGCCTATGTGGAAGGACTTGTGG - Intronic
1141859662 16:86707870-86707892 ACCCGATATTCAGGGAGTTGTGG + Intergenic
1143131269 17:4678994-4679016 TCCCTCTGTTGAGGGTGTTGAGG - Intronic
1143283700 17:5773514-5773536 ACCCCATGTGGAAGGCCTTGGGG + Intronic
1144456734 17:15424964-15424986 ACCCTGTGTGGGAGGACTTGTGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145960484 17:28884085-28884107 GCCCTCTCTTGTGGGACTTGCGG + Intronic
1146988433 17:37244440-37244462 ACCTTCAGTTGTGGGACTTGAGG - Intronic
1147184510 17:38705956-38705978 ACCCTAAGTTGAGGGAGTTTGGG + Intronic
1147540724 17:41356540-41356562 TCCCTATGTAGAGGGAACTGGGG - Intergenic
1149307057 17:55358204-55358226 ACCCTATGTTGATGGGCCTGTGG - Intergenic
1150270868 17:63863872-63863894 ACCATCTGTTGTGGGTCTTGGGG + Intergenic
1150274496 17:63887403-63887425 ACCATCTGTTGCGGGTCTTGGGG + Intergenic
1150276633 17:63902201-63902223 ACCATCTGTTGTGGGTCTTGGGG + Intergenic
1150306669 17:64091517-64091539 ACCCTCTGTTGTGGCACTTCTGG - Intronic
1153521537 18:5958900-5958922 ACCCTACGTGGACAGACTTGAGG + Intronic
1154435862 18:14341150-14341172 ACCCTGTGCTGTGGGACTAGGGG - Intergenic
1155095969 18:22556924-22556946 GCCCTACGTTGCAGGACTTGGGG - Intergenic
1156222541 18:35067079-35067101 ACCATGTGTTAAGGGACCTGTGG - Intronic
1156939220 18:42744584-42744606 ATCTTATGTTGAGGAAATTGGGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1166961679 19:46500559-46500581 ACTCTATGTTGAGTCATTTGAGG + Intronic
1167254819 19:48420948-48420970 ACCGTTTGTTGAGGGACTGGTGG + Intronic
1167812524 19:51847057-51847079 ACCCTATTTTGTGTGACTTTGGG - Intergenic
926001211 2:9334306-9334328 ATCCCAGGGTGAGGGACTTGGGG - Intronic
928318308 2:30263157-30263179 AATCGATGTTGAGGGACCTGAGG + Intronic
929542516 2:42833343-42833365 CCACTTTTTTGAGGGACTTGGGG + Intergenic
931447788 2:62341374-62341396 ACACTATGTTGGGTGACTTGAGG - Intergenic
933253254 2:80052172-80052194 AAACTATGTTGAGAGAGTTGTGG + Intronic
939021017 2:136958602-136958624 TCACTATTTTGAGGGAATTGGGG + Intronic
942270306 2:174267864-174267886 ACCCTGGGCTGAGGGAATTGAGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1171344771 20:24457677-24457699 ACTCTATGTTGGGGGAGTTGAGG + Intergenic
1171998135 20:31749373-31749395 ATTCTATACTGAGGGACTTGAGG - Intronic
1176197528 20:63844345-63844367 AACCTAGGATGAGGGACTGGAGG + Intergenic
1176841171 21:13844484-13844506 ACCCTGTGCTGTGGGACTAGGGG + Intergenic
949092098 3:40384-40406 AATCTAGGTTGAGGTACTTGAGG + Intergenic
952538171 3:34335882-34335904 ACCCTCTGTTGAGCCACTTCAGG - Intergenic
952736201 3:36693920-36693942 ACTCTATGTTGAGTTACTGGAGG + Intergenic
952817181 3:37455865-37455887 TTCCCATGTTGAGGGACCTGCGG + Intronic
953282972 3:41576384-41576406 ACCCAATGCTGAGTGCCTTGAGG + Intronic
957032353 3:75256330-75256352 AATCTAGGTTGAGGTACTTGAGG + Intergenic
960630644 3:119726959-119726981 ACAATATGCTGAGGTACTTGTGG + Intronic
962928785 3:140018783-140018805 TCCTTATCTTGAGTGACTTGGGG - Intronic
966462385 3:180191068-180191090 ACCCTATTTCCAGGGTCTTGAGG - Intergenic
968227163 3:196979966-196979988 TCCGTATGTGGAGGAACTTGGGG + Intergenic
969696733 4:8739159-8739181 ACCCTATCCTGACGGACATGGGG + Intergenic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
978027521 4:103896309-103896331 ACCCTCTGCTGGGAGACTTGAGG + Intergenic
980437923 4:132802818-132802840 ACCCTTTGTTGATGGATCTGTGG + Intergenic
981025331 4:140072026-140072048 AACCAATGTTGAGGTACTTGTGG - Intronic
983866710 4:172775787-172775809 ACCTCATCTTGATGGACTTGAGG + Intronic
989437172 5:41428323-41428345 ACCCTATTCTGAGGTACTGGGGG - Intronic
994113314 5:96033196-96033218 ATCCCATGTTGATAGACTTGGGG + Intergenic
998215369 5:140234702-140234724 CCAGTATGTTGAGGGACTTGTGG + Intronic
1002633642 5:180596613-180596635 ACCCTTTTTCAAGGGACTTGTGG + Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1005057973 6:21747693-21747715 ACCAAATGTAGAGGGCCTTGAGG - Intergenic
1005263826 6:24090284-24090306 ACCCTATATGAAGGGACTTGAGG - Intergenic
1006151500 6:31992520-31992542 TGCCCATGTTGAGGGGCTTGTGG - Exonic
1006157801 6:32025258-32025280 TGCCCATGTTGAGGGGCTTGTGG - Exonic
1006293406 6:33158245-33158267 ACTCTAGGTTGAAGGACTTTTGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1015369602 6:132436029-132436051 AACCTATGTCCTGGGACTTGTGG - Intergenic
1015909129 6:138148997-138149019 ACCCGATGTTGATGGAGATGTGG - Intergenic
1016902999 6:149120496-149120518 GCCCCATGTTGAGAGACTTCAGG - Intergenic
1021959936 7:25860875-25860897 CGCCTCTGTGGAGGGACTTGGGG + Intergenic
1024386073 7:48753553-48753575 ACCCTATGCAGAGAGACATGGGG + Intergenic
1025259884 7:57411799-57411821 ACTCTATGTTGATGGTCTGGGGG + Intergenic
1032752909 7:134859790-134859812 ACACCATGTTTAGGGACTTTAGG - Intronic
1034145129 7:148863765-148863787 AACTTCTGTTGAAGGACTTGGGG + Intronic
1038356612 8:26835294-26835316 ACACTATTTTGAGGTAGTTGGGG + Intronic
1039149655 8:34489815-34489837 ACCCTAAGGTGAGGGAAATGAGG + Intergenic
1041626297 8:60031395-60031417 ACTCTATGTTTGGGTACTTGTGG - Intergenic
1042024668 8:64410214-64410236 ACCCTGTGTTAAAAGACTTGCGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043688905 8:83125678-83125700 AGCCTAAGTTGAAGGACTAGTGG - Intergenic
1044279843 8:90341760-90341782 ATGATATGGTGAGGGACTTGGGG + Intergenic
1045401887 8:101827447-101827469 ACTATTTGTTCAGGGACTTGTGG - Intronic
1047005114 8:120611993-120612015 ACTCTGTTTGGAGGGACTTGTGG - Intronic
1049851865 8:144836880-144836902 ATCCTTTGTGCAGGGACTTGAGG + Intronic
1050681665 9:8118607-8118629 ACACTATCCTGCGGGACTTGAGG + Intergenic
1050979993 9:11997553-11997575 ACTCTATGTCAAGGGATTTGGGG - Intergenic
1052362428 9:27575220-27575242 ACCCTTGGTTGGGGGGCTTGGGG + Intergenic
1054778789 9:69147392-69147414 AACCTATGATTAGGGAATTGGGG + Intronic
1059198339 9:112391968-112391990 AACCTATGTTGAAATACTTGGGG - Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186289524 X:8081172-8081194 CTCCTGTGTTGAGGTACTTGGGG + Intergenic
1189852993 X:45195383-45195405 ACCCTATGTTGAGGGACTTGGGG - Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1199170226 X:144726642-144726664 ACCCACTGTTGAGAGACTTCAGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201169160 Y:11239690-11239712 TCAGTTTGTTGAGGGACTTGAGG + Intergenic